ID: 980363847

View in Genome Browser
Species Human (GRCh38)
Location 4:131773301-131773323
Sequence TCATAATACAAGCTCATTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980363847_980363848 13 Left 980363847 4:131773301-131773323 CCGGTAATGAGCTTGTATTATGA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data
980363847_980363849 16 Left 980363847 4:131773301-131773323 CCGGTAATGAGCTTGTATTATGA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 980363849 4:131773340-131773362 TATCACTTTAACGCAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980363847 Original CRISPR TCATAATACAAGCTCATTAC CGG (reversed) Intergenic
907820248 1:57960409-57960431 ACATTATACAAACTCAATACAGG + Intronic
908054516 1:60269183-60269205 TCAAAATACAAGCACATTTCTGG + Intergenic
908460556 1:64344739-64344761 ACATACTACTAGCTCAGTACAGG + Intergenic
908621724 1:65989127-65989149 TCATAATAAAATATCATTAAAGG - Intronic
915817236 1:158981077-158981099 TAAAAATACAAAATCATTACTGG - Intergenic
916709321 1:167389117-167389139 TCATAATTCAAAATCATTAAGGG - Intronic
923324364 1:232868188-232868210 TCAAAATACAAATTCATTAAGGG + Intergenic
923737620 1:236626124-236626146 TCACAATAAAAGATCTTTACTGG - Intergenic
1064937975 10:20701256-20701278 TTATAATACAAGGTCATCTCAGG + Intergenic
1067308955 10:45094312-45094334 TCCGAATACAAGCTCCTTCCAGG - Intergenic
1068920420 10:62477661-62477683 TCATACTAAATGCCCATTACAGG + Intronic
1069079456 10:64072626-64072648 TCATAATACATGAACATGACTGG - Intergenic
1069542406 10:69305118-69305140 TCATAATCCAAGATGATTGCAGG + Intronic
1075062943 10:119269437-119269459 TCATAATGTGAGCCCATTACAGG - Intronic
1075130959 10:119739304-119739326 TAAAAATCCAAGCTCATTCCTGG + Intronic
1075632816 10:124011322-124011344 ACAAAAGACAAGCTCATTAATGG + Intronic
1077808491 11:5613408-5613430 TTATAGTAAAAGCTCACTACTGG + Intronic
1084829916 11:71760857-71760879 TCATAAAAAATGCACATTACGGG - Intergenic
1085411578 11:76294046-76294068 TCCTGATGCAAGATCATTACTGG - Intergenic
1088681543 11:112247587-112247609 GCTTATTACAAGCTTATTACTGG + Intronic
1097613996 12:61861898-61861920 TTGTAATACAAGCTAATTACTGG - Intronic
1097666963 12:62489729-62489751 TCACATTAAAAGCACATTACAGG - Intronic
1101206614 12:102494631-102494653 ACATAATACAAACTCAGTAATGG - Intergenic
1110635707 13:77765548-77765570 TCATAATACAGGCTCATAGGTGG - Intergenic
1114313151 14:21485899-21485921 TCATAATAGAAGAACATTTCAGG + Intronic
1115176849 14:30572816-30572838 TCAAACTAGAAGCTAATTACAGG - Intronic
1116229332 14:42196008-42196030 ACATAATACAAACTCATTTATGG - Intergenic
1119376657 14:74199647-74199669 TCACTATACAAGCTAATTCCAGG - Exonic
1119397200 14:74335553-74335575 TAATAATATAGGTTCATTACAGG - Intronic
1119959660 14:78840552-78840574 TCATACTTCATGCTCATCACAGG + Intronic
1126114582 15:45197382-45197404 TCAAAATTCAAGCTCATTGAAGG - Intronic
1129480098 15:75817137-75817159 TCATAACACATTCTCATCACTGG + Intergenic
1131903499 15:97115465-97115487 TGATCATTCAAACTCATTACAGG - Intergenic
1133546264 16:6810555-6810577 TCATAATACAAACCTATAACTGG - Intronic
1133923053 16:10171756-10171778 TTATAATAAATGCTTATTACAGG - Intronic
1137035464 16:35565981-35566003 TCATAATGCACTCTAATTACAGG + Intergenic
1140024857 16:71277363-71277385 TCATCATACATGCTCATAATGGG + Intergenic
1149946055 17:60928805-60928827 TAATGATACAAGCTGATTAATGG - Intronic
1150359271 17:64516545-64516567 GAATAATACATGCTCATTACAGG + Intronic
1150530090 17:65970737-65970759 TGTTAATACATGCACATTACAGG + Intronic
1155768009 18:29660148-29660170 ACATAATATAATATCATTACTGG - Intergenic
1160264756 18:77331964-77331986 TCTTAATACAAGTTCATCAAAGG - Intergenic
1165332715 19:35150184-35150206 TGAGATTACAGGCTCATTACAGG + Intronic
1165879935 19:39035149-39035171 TCATGACAGAAGCACATTACAGG - Intergenic
926447430 2:12960982-12961004 TCCTAATACCAGCACATTGCAGG - Intergenic
928822099 2:35373462-35373484 TAATATTACAAGCTCATAAGTGG + Intergenic
929632266 2:43475737-43475759 TTATAATGCAAGCTGCTTACAGG + Intronic
931427114 2:62181277-62181299 TAAAAATACAATCTCACTACTGG - Intergenic
931877804 2:66532983-66533005 TCACAATACGAGCTCATCAATGG - Intronic
933188817 2:79310130-79310152 TCATAATATATGCAAATTACAGG + Intronic
936492017 2:112980092-112980114 TCACAATACAAACACATTTCTGG - Exonic
942397248 2:175563901-175563923 TAATAATACAAACCCATTACTGG + Intergenic
943453785 2:188077761-188077783 TGATAATGCATGTTCATTACTGG + Intergenic
945015863 2:205515358-205515380 TCAAACAACAATCTCATTACTGG - Intronic
1169587971 20:7107946-7107968 TCATAATACTAAATAATTACAGG - Intergenic
1170538822 20:17368107-17368129 TCCTAATACAAGCTCTTTTGGGG + Intronic
1176694189 21:9954174-9954196 TTGTAATTCAAGCTCATTTCTGG + Intergenic
949688201 3:6602352-6602374 TCATAATACAAGATAATTTTTGG - Intergenic
950950255 3:16991289-16991311 TCATAATAGTAGCTCAGTAAAGG + Intronic
951066545 3:18273422-18273444 TCCAAATACAAACACATTACTGG - Intronic
952899704 3:38101918-38101940 TGATAATACAAGGTCCTTTCAGG - Intronic
953824069 3:46234806-46234828 TCATAAAACAAGCTAAATGCTGG - Intronic
955523745 3:59800220-59800242 TCAGACTAAAAGCTGATTACTGG + Intronic
955579585 3:60404772-60404794 CCATAATACAAGCTCAGTATTGG + Intronic
955604583 3:60687123-60687145 GCATAATACAAGATATTTACTGG - Intronic
958183699 3:90091282-90091304 TCATATTACAACATCATTAGAGG + Intergenic
958919904 3:100092853-100092875 TCACAAGACAAACTCATTCCAGG + Intronic
959098705 3:101985988-101986010 TCATGACACAACCTCATGACAGG + Intergenic
960631323 3:119734221-119734243 TTATAATACACTCTCATCACTGG + Intronic
960929573 3:122832203-122832225 TCAAATTACAAGCTAATTAATGG + Intronic
961966090 3:130904447-130904469 TCATAAGACATGCTAATCACGGG - Intronic
970467467 4:16340765-16340787 TCATGATACAAGATGATGACAGG - Intergenic
974898022 4:67962849-67962871 TGAGAAAACAAGCTCAATACTGG - Intronic
977120002 4:93087748-93087770 TCATTAAACAAGGGCATTACTGG - Intronic
977433399 4:96961549-96961571 TGTTAATACAAATTCATTACTGG + Intergenic
979033531 4:115682210-115682232 TCTTAATACAAACTAATTACAGG + Intergenic
980363847 4:131773301-131773323 TCATAATACAAGCTCATTACCGG - Intergenic
980366811 4:131814372-131814394 TTTTAATTCAAGCTCATTTCTGG + Intergenic
980532884 4:134077337-134077359 TCATAAAACAATCTTACTACTGG - Intergenic
982541737 4:156681029-156681051 TCATAATATAAGTTCTTTAGAGG + Intergenic
983760230 4:171396112-171396134 TCAAAATACAAAGTAATTACTGG - Intergenic
984874925 4:184358986-184359008 TCCTTATAAAAGCTCATTTCAGG - Intergenic
987681262 5:21138785-21138807 TCATAATACAATCTTACGACAGG + Intergenic
989188981 5:38651328-38651350 TTATAATACAAGATCCTTATAGG - Intergenic
990118350 5:52417397-52417419 TCATAATACTATCTCAATACCGG + Intergenic
990613111 5:57479105-57479127 TCAAAATCCCAGCACATTACAGG - Intergenic
994026313 5:95088337-95088359 TCATATTTCAAGGTCATTTCTGG - Intronic
994828900 5:104751891-104751913 TCATACTAAAAGCAAATTACGGG - Intergenic
995633130 5:114155638-114155660 TCATAATAAAAGCTCAACATTGG - Intergenic
996195244 5:120597962-120597984 TCATAATCCATATTCATTACTGG - Intronic
1000285606 5:159823798-159823820 TCCTAATACAATCACATTTCAGG + Intergenic
1000425076 5:161080679-161080701 TCATACTACAAGTTCATTGATGG - Intergenic
1008805262 6:55419044-55419066 TCACACTACAAGCCCATTACAGG + Intergenic
1009684698 6:66942317-66942339 TCATAAGAAATGCTCATCACAGG + Intergenic
1010737175 6:79456113-79456135 TTATAATACAAAACCATTACAGG + Intergenic
1012747481 6:103111769-103111791 TCATAATCCAAGATAAATACTGG + Intergenic
1013282484 6:108651713-108651735 TGACAATGCAAGCACATTACAGG - Intronic
1013318968 6:108968021-108968043 TAATAATACAGGATAATTACAGG - Intronic
1013727894 6:113122544-113122566 TGCTCATACAATCTCATTACTGG - Intergenic
1015088703 6:129328889-129328911 ACATAATACAACCTCATGATAGG - Intronic
1016076440 6:139802181-139802203 TGAGAATACAGGCTCATGACTGG - Intergenic
1016768975 6:147827692-147827714 TTCTAATGCAAGCTCATTAGAGG - Intergenic
1021165872 7:17339930-17339952 TGGTAATACAGGCTGATTACAGG - Exonic
1021773316 7:24026685-24026707 TCATGATACATGCTCATTATGGG - Intergenic
1021844399 7:24750067-24750089 TCATACTACATGCACAATACAGG + Intronic
1024127629 7:46316653-46316675 TCATAATACAAGATGGCTACTGG - Intergenic
1024346164 7:48316308-48316330 TCATAAAAAAAGCTCAGTTCCGG + Intronic
1026197978 7:68189407-68189429 TCCAAATACAATCTCATTGCAGG - Intergenic
1030281556 7:107781280-107781302 CCATAATAAAAGCTCATAATAGG - Intronic
1030474527 7:110013528-110013550 TCCTAATAAAAGCACATTAGTGG + Intergenic
1031716230 7:125112124-125112146 TCATAATCATAGCTCATTACAGG - Intergenic
1032735178 7:134686189-134686211 TCAGCACACAAGCTCATTGCTGG - Intergenic
1037021100 8:13971786-13971808 TCATATTGCAAACTGATTACTGG - Intergenic
1037859453 8:22394304-22394326 ACATAATAAAAAATCATTACAGG - Intronic
1037883969 8:22586634-22586656 TCTTGAAACAAGCTCATTCCTGG - Intronic
1041137665 8:54777669-54777691 TCAAAATACAACCTCATAAGAGG - Intergenic
1044468097 8:92531049-92531071 TAATAATTCAATCTCATTATTGG - Intergenic
1050162345 9:2731708-2731730 TCATAATCCTAGCTCCTTATGGG - Intronic
1056782168 9:89558881-89558903 TCCTAATACAATCACATTTCAGG + Intergenic
1057745535 9:97747979-97748001 GCTTTATACAAGCTAATTACTGG + Intergenic
1058356735 9:104092743-104092765 TCAAAATATAAGCCCATTCCTGG + Intergenic
1188404326 X:29787866-29787888 TCATAATACAAGCTATTCAAGGG + Intronic
1188603515 X:31999228-31999250 TTATAATACCAGCTAATAACTGG + Intronic
1190359773 X:49637857-49637879 TCAGAATCCCAGCTCATGACCGG - Intergenic
1190583941 X:51918706-51918728 TCCTAATACATGCTCATGAAAGG + Intergenic
1191041215 X:56082111-56082133 TACTAATTCAAGCTCCTTACTGG + Intergenic
1194078938 X:89433383-89433405 TCATGATACAAAATTATTACCGG - Intergenic
1194388296 X:93284590-93284612 TCAGAATTCATTCTCATTACTGG + Intergenic
1194412255 X:93571630-93571652 TCAGAATACAAGGTCATCTCTGG + Intergenic
1194675953 X:96793739-96793761 TCCTAATACAATCACATTGCAGG + Intronic
1196561715 X:117157335-117157357 GCAAAATACAAGATTATTACAGG - Intergenic
1196772747 X:119311072-119311094 TCATAGTACAAGGTTATTTCTGG - Intergenic
1197115405 X:122826649-122826671 TTAAAATACAATCTCATTATTGG + Intergenic
1198822871 X:140667690-140667712 TACTAATTCAATCTCATTACTGG + Intergenic
1200035196 X:153322077-153322099 TCCTCATACCAGCTCTTTACCGG + Intergenic
1200431561 Y:3088705-3088727 TCATGATACAAAATTATTACCGG - Intergenic
1200586275 Y:5008415-5008437 TCAGATTACAAACTCATTTCAGG + Intronic