ID: 980363848

View in Genome Browser
Species Human (GRCh38)
Location 4:131773337-131773359
Sequence CTTTATCACTTTAACGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980363847_980363848 13 Left 980363847 4:131773301-131773323 CCGGTAATGAGCTTGTATTATGA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data
980363845_980363848 20 Left 980363845 4:131773294-131773316 CCCAGCACCGGTAATGAGCTTGT 0: 1
1: 0
2: 2
3: 8
4: 39
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data
980363846_980363848 19 Left 980363846 4:131773295-131773317 CCAGCACCGGTAATGAGCTTGTA 0: 1
1: 0
2: 2
3: 4
4: 44
Right 980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980363848 Original CRISPR CTTTATCACTTTAACGCAGA TGG Intergenic
No off target data available for this crispr