ID: 980367037

View in Genome Browser
Species Human (GRCh38)
Location 4:131818194-131818216
Sequence CTGAATGAAAACCAGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980367029_980367037 21 Left 980367029 4:131818150-131818172 CCTGGTTGAATAATTCAGATTTC No data
Right 980367037 4:131818194-131818216 CTGAATGAAAACCAGCAGATTGG No data
980367034_980367037 -5 Left 980367034 4:131818176-131818198 CCAGTAGGGTAGGTGTCCCTGAA No data
Right 980367037 4:131818194-131818216 CTGAATGAAAACCAGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980367037 Original CRISPR CTGAATGAAAACCAGCAGAT TGG Intergenic
No off target data available for this crispr