ID: 980368080

View in Genome Browser
Species Human (GRCh38)
Location 4:131832361-131832383
Sequence TGGAACACAGCAGGTCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368080_980368088 23 Left 980368080 4:131832361-131832383 CCACTCTGACCTGCTGTGTTCCA No data
Right 980368088 4:131832407-131832429 GGTGAGCAGGTACAGGAGCCAGG 0: 9
1: 39
2: 87
3: 139
4: 520
980368080_980368085 2 Left 980368080 4:131832361-131832383 CCACTCTGACCTGCTGTGTTCCA No data
Right 980368085 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
980368080_980368086 10 Left 980368080 4:131832361-131832383 CCACTCTGACCTGCTGTGTTCCA No data
Right 980368086 4:131832394-131832416 GAGAGAGCATGCAGGTGAGCAGG No data
980368080_980368087 16 Left 980368080 4:131832361-131832383 CCACTCTGACCTGCTGTGTTCCA No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368080 Original CRISPR TGGAACACAGCAGGTCAGAG TGG (reversed) Intergenic
No off target data available for this crispr