ID: 980368081

View in Genome Browser
Species Human (GRCh38)
Location 4:131832370-131832392
Sequence TGCAAGGTGTGGAACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368081_980368086 1 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368086 4:131832394-131832416 GAGAGAGCATGCAGGTGAGCAGG No data
980368081_980368088 14 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368088 4:131832407-131832429 GGTGAGCAGGTACAGGAGCCAGG 0: 9
1: 39
2: 87
3: 139
4: 520
980368081_980368091 29 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368091 4:131832422-131832444 GAGCCAGGAAGAGAGCTTTGGGG No data
980368081_980368087 7 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368081_980368089 27 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368089 4:131832420-131832442 AGGAGCCAGGAAGAGAGCTTTGG No data
980368081_980368085 -7 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368085 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
980368081_980368090 28 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368090 4:131832421-131832443 GGAGCCAGGAAGAGAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368081 Original CRISPR TGCAAGGTGTGGAACACAGC AGG (reversed) Intergenic
No off target data available for this crispr