ID: 980368083

View in Genome Browser
Species Human (GRCh38)
Location 4:131832381-131832403
Sequence ATGCTCTCTCCTGCAAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368083_980368086 -10 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368086 4:131832394-131832416 GAGAGAGCATGCAGGTGAGCAGG No data
980368083_980368091 18 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368091 4:131832422-131832444 GAGCCAGGAAGAGAGCTTTGGGG No data
980368083_980368093 24 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368093 4:131832428-131832450 GGAAGAGAGCTTTGGGGTGTTGG No data
980368083_980368094 28 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368094 4:131832432-131832454 GAGAGCTTTGGGGTGTTGGCAGG No data
980368083_980368089 16 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368089 4:131832420-131832442 AGGAGCCAGGAAGAGAGCTTTGG No data
980368083_980368090 17 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368090 4:131832421-131832443 GGAGCCAGGAAGAGAGCTTTGGG No data
980368083_980368087 -4 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368083_980368088 3 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368088 4:131832407-131832429 GGTGAGCAGGTACAGGAGCCAGG 0: 9
1: 39
2: 87
3: 139
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368083 Original CRISPR ATGCTCTCTCCTGCAAGGTG TGG (reversed) Intergenic
No off target data available for this crispr