ID: 980368084

View in Genome Browser
Species Human (GRCh38)
Location 4:131832386-131832408
Sequence CCTGCATGCTCTCTCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368084_980368089 11 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368089 4:131832420-131832442 AGGAGCCAGGAAGAGAGCTTTGG No data
980368084_980368091 13 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368091 4:131832422-131832444 GAGCCAGGAAGAGAGCTTTGGGG No data
980368084_980368094 23 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368094 4:131832432-131832454 GAGAGCTTTGGGGTGTTGGCAGG No data
980368084_980368093 19 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368093 4:131832428-131832450 GGAAGAGAGCTTTGGGGTGTTGG No data
980368084_980368088 -2 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368088 4:131832407-131832429 GGTGAGCAGGTACAGGAGCCAGG 0: 9
1: 39
2: 87
3: 139
4: 520
980368084_980368090 12 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368090 4:131832421-131832443 GGAGCCAGGAAGAGAGCTTTGGG No data
980368084_980368087 -9 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368084 Original CRISPR CCTGCATGCTCTCTCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr