ID: 980368087

View in Genome Browser
Species Human (GRCh38)
Location 4:131832400-131832422
Sequence GCATGCAGGTGAGCAGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368079_980368087 17 Left 980368079 4:131832360-131832382 CCCACTCTGACCTGCTGTGTTCC No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368083_980368087 -4 Left 980368083 4:131832381-131832403 CCACACCTTGCAGGAGAGAGCAT No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368080_980368087 16 Left 980368080 4:131832361-131832383 CCACTCTGACCTGCTGTGTTCCA No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368081_980368087 7 Left 980368081 4:131832370-131832392 CCTGCTGTGTTCCACACCTTGCA No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data
980368084_980368087 -9 Left 980368084 4:131832386-131832408 CCTTGCAGGAGAGAGCATGCAGG No data
Right 980368087 4:131832400-131832422 GCATGCAGGTGAGCAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368087 Original CRISPR GCATGCAGGTGAGCAGGTAC AGG Intergenic
No off target data available for this crispr