ID: 980368102

View in Genome Browser
Species Human (GRCh38)
Location 4:131832474-131832496
Sequence CTCAAACCCAGGTGCTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368102_980368109 8 Left 980368102 4:131832474-131832496 CCATAGCAGCACCTGGGTTTGAG No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data
980368102_980368110 9 Left 980368102 4:131832474-131832496 CCATAGCAGCACCTGGGTTTGAG No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368102 Original CRISPR CTCAAACCCAGGTGCTGCTA TGG (reversed) Intergenic
No off target data available for this crispr