ID: 980368109

View in Genome Browser
Species Human (GRCh38)
Location 4:131832505-131832527
Sequence TGTGATTCCTGAAACCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368107_980368109 -3 Left 980368107 4:131832485-131832507 CCTGGGTTTGAGGGGGTGCCTGT No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data
980368100_980368109 10 Left 980368100 4:131832472-131832494 CCCCATAGCAGCACCTGGGTTTG No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data
980368102_980368109 8 Left 980368102 4:131832474-131832496 CCATAGCAGCACCTGGGTTTGAG No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data
980368097_980368109 19 Left 980368097 4:131832463-131832485 CCATGTGGGCCCCATAGCAGCAC No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data
980368101_980368109 9 Left 980368101 4:131832473-131832495 CCCATAGCAGCACCTGGGTTTGA No data
Right 980368109 4:131832505-131832527 TGTGATTCCTGAAACCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368109 Original CRISPR TGTGATTCCTGAAACCCCAG TGG Intergenic
No off target data available for this crispr