ID: 980368110

View in Genome Browser
Species Human (GRCh38)
Location 4:131832506-131832528
Sequence GTGATTCCTGAAACCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980368102_980368110 9 Left 980368102 4:131832474-131832496 CCATAGCAGCACCTGGGTTTGAG No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data
980368107_980368110 -2 Left 980368107 4:131832485-131832507 CCTGGGTTTGAGGGGGTGCCTGT No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data
980368097_980368110 20 Left 980368097 4:131832463-131832485 CCATGTGGGCCCCATAGCAGCAC No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data
980368100_980368110 11 Left 980368100 4:131832472-131832494 CCCCATAGCAGCACCTGGGTTTG No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data
980368101_980368110 10 Left 980368101 4:131832473-131832495 CCCATAGCAGCACCTGGGTTTGA No data
Right 980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980368110 Original CRISPR GTGATTCCTGAAACCCCAGT GGG Intergenic
No off target data available for this crispr