ID: 980369432

View in Genome Browser
Species Human (GRCh38)
Location 4:131848414-131848436
Sequence TCTTATGTAAGATTAACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980369426_980369432 20 Left 980369426 4:131848371-131848393 CCAAACAAGCCCATTTTTCTTTT No data
Right 980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG No data
980369428_980369432 10 Left 980369428 4:131848381-131848403 CCATTTTTCTTTTGTTAGCCATT No data
Right 980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG No data
980369429_980369432 -8 Left 980369429 4:131848399-131848421 CCATTGCCTTCTTCCTCTTATGT No data
Right 980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG No data
980369427_980369432 11 Left 980369427 4:131848380-131848402 CCCATTTTTCTTTTGTTAGCCAT No data
Right 980369432 4:131848414-131848436 TCTTATGTAAGATTAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980369432 Original CRISPR TCTTATGTAAGATTAACTTA TGG Intergenic
No off target data available for this crispr