ID: 980372754

View in Genome Browser
Species Human (GRCh38)
Location 4:131899111-131899133
Sequence CTGTTGTTGTTAAGAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980372754_980372757 26 Left 980372754 4:131899111-131899133 CCTTATTTTCTTAACAACAACAG No data
Right 980372757 4:131899160-131899182 TGCCCCATGCACCTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980372754 Original CRISPR CTGTTGTTGTTAAGAAAATA AGG (reversed) Intergenic
No off target data available for this crispr