ID: 980376572

View in Genome Browser
Species Human (GRCh38)
Location 4:131957329-131957351
Sequence CAGGCACATGGTGCTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980376564_980376572 24 Left 980376564 4:131957282-131957304 CCTTCTGGCTGCTTTTGTGGGCT No data
Right 980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG No data
980376561_980376572 28 Left 980376561 4:131957278-131957300 CCTGCCTTCTGGCTGCTTTTGTG No data
Right 980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980376572 Original CRISPR CAGGCACATGGTGCTGTTGG TGG Intergenic
No off target data available for this crispr