ID: 980382701

View in Genome Browser
Species Human (GRCh38)
Location 4:132045206-132045228
Sequence GACTTAAACAACTGGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980382701_980382703 -7 Left 980382701 4:132045206-132045228 CCTGAGTGCCAGTTGTTTAAGTC No data
Right 980382703 4:132045222-132045244 TTAAGTCCCAGTCTGAAATCAGG No data
980382701_980382706 25 Left 980382701 4:132045206-132045228 CCTGAGTGCCAGTTGTTTAAGTC No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980382701 Original CRISPR GACTTAAACAACTGGCACTC AGG (reversed) Intergenic
No off target data available for this crispr