ID: 980382704

View in Genome Browser
Species Human (GRCh38)
Location 4:132045228-132045250
Sequence TCTTCTCCTGATTTCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980382704_980382706 3 Left 980382704 4:132045228-132045250 CCCAGTCTGAAATCAGGAGAAGA No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980382704 Original CRISPR TCTTCTCCTGATTTCAGACT GGG (reversed) Intergenic
No off target data available for this crispr