ID: 980382705

View in Genome Browser
Species Human (GRCh38)
Location 4:132045229-132045251
Sequence GTCTTCTCCTGATTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980382705_980382706 2 Left 980382705 4:132045229-132045251 CCAGTCTGAAATCAGGAGAAGAC No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980382705 Original CRISPR GTCTTCTCCTGATTTCAGAC TGG (reversed) Intergenic
No off target data available for this crispr