ID: 980382706

View in Genome Browser
Species Human (GRCh38)
Location 4:132045254-132045276
Sequence ATGTCACAGCTGAAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980382704_980382706 3 Left 980382704 4:132045228-132045250 CCCAGTCTGAAATCAGGAGAAGA No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data
980382701_980382706 25 Left 980382701 4:132045206-132045228 CCTGAGTGCCAGTTGTTTAAGTC No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data
980382702_980382706 17 Left 980382702 4:132045214-132045236 CCAGTTGTTTAAGTCCCAGTCTG No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data
980382705_980382706 2 Left 980382705 4:132045229-132045251 CCAGTCTGAAATCAGGAGAAGAC No data
Right 980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980382706 Original CRISPR ATGTCACAGCTGAAGCAGTG AGG Intergenic
No off target data available for this crispr