ID: 980384498

View in Genome Browser
Species Human (GRCh38)
Location 4:132069712-132069734
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980384498_980384503 8 Left 980384498 4:132069712-132069734 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 980384503 4:132069743-132069765 TCTTCAGCCTCCCGAGTAGGTGG No data
980384498_980384504 9 Left 980384498 4:132069712-132069734 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 980384504 4:132069744-132069766 CTTCAGCCTCCCGAGTAGGTGGG 0: 57
1: 4966
2: 121416
3: 306328
4: 220381
980384498_980384506 17 Left 980384498 4:132069712-132069734 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 980384506 4:132069752-132069774 TCCCGAGTAGGTGGGATTACAGG 0: 447
1: 47905
2: 213943
3: 256010
4: 187384
980384498_980384502 5 Left 980384498 4:132069712-132069734 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 980384502 4:132069740-132069762 CCTTCTTCAGCCTCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980384498 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr