ID: 980386303

View in Genome Browser
Species Human (GRCh38)
Location 4:132090774-132090796
Sequence CAGCAAACAGCAGTGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980386300_980386303 13 Left 980386300 4:132090738-132090760 CCAGAGGGATGGAAGTCAGAGGC No data
Right 980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG No data
980386298_980386303 19 Left 980386298 4:132090732-132090754 CCGGATCCAGAGGGATGGAAGTC 0: 25
1: 61
2: 115
3: 90
4: 155
Right 980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980386303 Original CRISPR CAGCAAACAGCAGTGATGGA TGG Intergenic
No off target data available for this crispr