ID: 980387950

View in Genome Browser
Species Human (GRCh38)
Location 4:132111211-132111233
Sequence AGTTATCTGCAGAATATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980387944_980387950 25 Left 980387944 4:132111163-132111185 CCACCAAAGTCCAGTAACAGGCC 0: 8
1: 152
2: 160
3: 95
4: 183
Right 980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG No data
980387948_980387950 4 Left 980387948 4:132111184-132111206 CCAAGTGTTGTCTCTCAAAAGGA No data
Right 980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG No data
980387946_980387950 15 Left 980387946 4:132111173-132111195 CCAGTAACAGGCCAAGTGTTGTC No data
Right 980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG No data
980387945_980387950 22 Left 980387945 4:132111166-132111188 CCAAAGTCCAGTAACAGGCCAAG 0: 8
1: 181
2: 166
3: 110
4: 213
Right 980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980387950 Original CRISPR AGTTATCTGCAGAATATGGC AGG Intergenic
No off target data available for this crispr