ID: 980389420

View in Genome Browser
Species Human (GRCh38)
Location 4:132123875-132123897
Sequence CACAAGGACGCCCATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980389416_980389420 2 Left 980389416 4:132123850-132123872 CCCAAAGCCTGTTTGGTGGTCTC No data
Right 980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG 0: 1
1: 1
2: 1
3: 24
4: 120
980389417_980389420 1 Left 980389417 4:132123851-132123873 CCAAAGCCTGTTTGGTGGTCTCT No data
Right 980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG 0: 1
1: 1
2: 1
3: 24
4: 120
980389418_980389420 -5 Left 980389418 4:132123857-132123879 CCTGTTTGGTGGTCTCTTCACAA 0: 30
1: 1792
2: 759
3: 214
4: 148
Right 980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG 0: 1
1: 1
2: 1
3: 24
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980389420 Original CRISPR CACAAGGACGCCCATGAAAA TGG Intergenic
902687609 1:18089084-18089106 CACAAGGAAGTGCATGAAATGGG + Intergenic
912915563 1:113811754-113811776 CACAAGGACAAGCAGGAAAACGG - Exonic
912927149 1:113923266-113923288 CACAGAGACCCACATGAAAAGGG - Intergenic
917789352 1:178489498-178489520 CAGAAGGACGCCCATCACACAGG + Intergenic
918567158 1:185948273-185948295 CACATGGACACGCATGAAATGGG - Intronic
920187390 1:204168851-204168873 CCCAAGGACGCTCATGGAAGAGG + Intergenic
922035771 1:221846394-221846416 CACAACGACATCCATGCAAAAGG + Intergenic
922153566 1:223024390-223024412 CACACGGATGTGCATGAAAAAGG - Intergenic
922654665 1:227371188-227371210 CTCAGGGAGTCCCATGAAAATGG - Intergenic
1064908259 10:20370840-20370862 CACACGGACGCGCATGAAAGTGG - Intergenic
1067910695 10:50343867-50343889 CACAAGAACGGCCATGCCAATGG - Exonic
1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG + Intronic
1073045892 10:100637970-100637992 CACTAGGAGGCTAATGAAAAGGG + Intergenic
1075138257 10:119806918-119806940 CTCAAGGAAGCCCATGAGACAGG - Intronic
1076832689 10:133004595-133004617 CACACGGACGCGCATGAAAGAGG + Intergenic
1077578047 11:3399177-3399199 CACACGGACGCGCATGAAACTGG + Intergenic
1078452345 11:11449578-11449600 CACAAGGGCTCCCATGAGCAGGG - Intronic
1079777651 11:24553885-24553907 CTCAAGGAAACTCATGAAAATGG - Intronic
1084356053 11:68639423-68639445 CACATGGACGCACATGAAAGTGG + Intergenic
1085795028 11:79531422-79531444 TACAAGGTCATCCATGAAAAAGG - Intergenic
1088852444 11:113715852-113715874 CACAAGGACCCCCATTTAGAGGG - Intergenic
1093321493 12:17720246-17720268 CACATGGATGCACATGAAAGAGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097278125 12:57826946-57826968 CACAAGAAGGCCCAAGATAAAGG + Intronic
1101907511 12:108838717-108838739 CACAAGGAAGCCCAGCATAATGG - Intronic
1102116204 12:110404974-110404996 CACACGGACGCACATGACAGTGG - Intergenic
1107767864 13:43756594-43756616 CACACGGATGCACATAAAAATGG - Intronic
1108017215 13:46088068-46088090 CACATGCACGCACAAGAAAAAGG - Intronic
1109708934 13:66138720-66138742 CACAAGGGAGCTGATGAAAAGGG - Intergenic
1112500651 13:99940563-99940585 CACAAAGAGGACGATGAAAACGG + Intergenic
1125004772 15:34804967-34804989 CCCAAGGACCCTCATGAGAAGGG - Intergenic
1126175731 15:45733565-45733587 CACAAGCACTCCTAGGAAAAAGG - Intergenic
1127605937 15:60588893-60588915 CAAGAGGCTGCCCATGAAAATGG + Intronic
1128271338 15:66312587-66312609 CACAAAGAGGCCCTTGAAAGGGG - Intronic
1131882004 15:96871831-96871853 CACACGGACGCGCATGAAAATGG - Intergenic
1133645011 16:7755755-7755777 AACAAGGAAGCCCAAGAGAATGG - Intergenic
1138208486 16:55143063-55143085 GACAAGGAGGCCCTTGACAAGGG - Intergenic
1141001071 16:80308525-80308547 TACAAGGAAGGCCAGGAAAATGG - Intergenic
1141425333 16:83941066-83941088 CACAAAGACTCCCATGGGAACGG + Intronic
1143665037 17:8352766-8352788 CACACGGACGCGCATGAAAGCGG - Intergenic
1146947632 17:36884746-36884768 CACAAGTCTGCCCGTGAAAATGG - Intergenic
1147415537 17:40286707-40286729 CACAAGCACCCCCATGAACCTGG - Intergenic
1148205404 17:45776726-45776748 CCCGAGGAAGCCCATGCAAATGG - Intergenic
1148233721 17:45953306-45953328 CTCAAGGATGCTCCTGAAAATGG + Intronic
1148569676 17:48658233-48658255 CAAAAGGCAGCTCATGAAAAAGG - Intergenic
1153713549 18:7823369-7823391 CAGAAGGATGCCCATGGACAGGG + Intronic
1153928727 18:9859242-9859264 CCCTTGGACCCCCATGAAAATGG + Exonic
1155540912 18:26867438-26867460 CACAAGGAAGCCCCTAAACATGG - Intergenic
1156297849 18:35808969-35808991 TACATGAAGGCCCATGAAAAAGG + Intergenic
1163547992 19:17950675-17950697 GACAAGGACACCCATGATCAGGG - Intergenic
1164193457 19:22932595-22932617 CACAAGGCCCACCATGAACAGGG - Intergenic
1167416314 19:49374924-49374946 CACAAGGACGTCCTAGAAGAGGG + Exonic
1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG + Intergenic
1168131284 19:54321241-54321263 CACACGGAAGCGCATGAAACCGG - Intergenic
926965619 2:18406798-18406820 CACAAGGATGCATATGTAAAGGG + Intergenic
927134692 2:20088107-20088129 CACACGGACGCACATGAAACCGG + Intergenic
927750957 2:25670607-25670629 CACAAGGACTCCAATGTGAATGG + Intronic
927819590 2:26251641-26251663 CACAAAGAGGCCCATGAGAGAGG - Intronic
933920543 2:87041125-87041147 CATGAGGAAGCCCAAGAAAAAGG + Intergenic
933931081 2:87152661-87152683 CATGAGGAAGCCCAAGAAAAAGG - Intergenic
934002454 2:87728773-87728795 CATGAGGAAGCCCAAGAAAAAGG - Intergenic
935111750 2:100100598-100100620 GACAAGAACACACATGAAAAAGG - Intronic
936123215 2:109764570-109764592 GACAAGAACACACATGAAAAAGG + Intergenic
936221467 2:110606899-110606921 GACAAGAACACACATGAAAAAGG - Intergenic
936362040 2:111812771-111812793 CATGAGGAAGCCCAAGAAAAAGG + Intronic
939268288 2:139904248-139904270 CACAAGCAAGCCCACAAAAATGG + Intergenic
939742737 2:145929775-145929797 CACAAGTAAGCCCTTTAAAAAGG + Intergenic
940716651 2:157233456-157233478 CACAAGGAATACCATGAGAAGGG - Intergenic
942928850 2:181465034-181465056 CACAAGGAGTCCCATAAAAGGGG - Intronic
943146407 2:184051288-184051310 CACAAGCACTCCCAGGAAAAGGG + Intergenic
947058242 2:226132568-226132590 GCCAAGGAAGGCCATGAAAAAGG - Intergenic
947300174 2:228680193-228680215 CAAAAGTAAGCCCATGAAAATGG + Intergenic
1170861846 20:20112004-20112026 CAAAAGGAAACCCATGGAAAAGG - Intronic
1172105230 20:32513189-32513211 CACAAGGAGGCCCAAGAGACAGG + Intronic
1177759705 21:25389583-25389605 CAAAAGGAAGCCGATGAAAGGGG - Intergenic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1182732781 22:32508485-32508507 CACACAGACGCGCATGAAAGGGG + Intergenic
956230842 3:67014509-67014531 AACATGGACTCCCATGAAAGTGG - Intergenic
957049221 3:75398477-75398499 CACATGGACGTGCATGAAAGTGG + Intergenic
957770494 3:84686088-84686110 TCCAAGGATGACCATGAAAAAGG - Intergenic
961881541 3:130064958-130064980 CACGCGGACGCGCATGAAACTGG + Intergenic
963062937 3:141239908-141239930 CACAAGGACTGGCATGAAACAGG + Intronic
964941657 3:162164701-162164723 CAAAAGGACACCCCTGAACATGG + Intergenic
965647940 3:170903640-170903662 CACAAGGATTCCCATGAAACAGG + Intronic
967213039 3:187185608-187185630 CACACGGACGCGCATGAAAGTGG + Intergenic
968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG + Intergenic
969653515 4:8482393-8482415 CACGCGGACGCTCATGAAAGGGG - Intronic
969822373 4:9730524-9730546 CACATGGACGCACATGAATCTGG - Intergenic
970084565 4:12332349-12332371 CAAAAGGAGGCTCATAAAAATGG + Intergenic
975173056 4:71255229-71255251 CACATGGACTCCGATGTAAATGG - Exonic
976351539 4:84065691-84065713 AACAAGGACGCCGATGGAAAAGG + Intergenic
978344076 4:107747996-107748018 CACATGGACACCCATGAAGCTGG - Intergenic
978469313 4:109045631-109045653 CACAAGGAAGCCCATGATATTGG + Intronic
979044359 4:115842863-115842885 GCCAGGGACGCCCATGAAAGAGG - Intergenic
979147095 4:117257772-117257794 CACAGGGACGCACATGAAACTGG + Intergenic
979687949 4:123531470-123531492 CACAGGGAGGCCCATGACTAAGG - Intergenic
979799527 4:124891441-124891463 ACCAAGGACGCCCATCCAAAGGG - Intergenic
980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG + Intergenic
980528409 4:134018364-134018386 CACACTGATGCGCATGAAAATGG + Intergenic
984232630 4:177117347-177117369 CACAAGGAAGCCCCAGATAATGG + Intergenic
984748822 4:183252190-183252212 TACAAGTTCTCCCATGAAAATGG + Intronic
987119255 5:14751147-14751169 CACAAGTGCGCCCATGTACAAGG + Exonic
996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG + Intergenic
996725936 5:126673464-126673486 CACACGGACACGCATGAAACAGG + Intergenic
1000095693 5:157969101-157969123 CACACGGACGCACGTGACAATGG + Intergenic
1000440301 5:161255003-161255025 CACAGGGACGCCAGTGAAAACGG + Intergenic
1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG + Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1008514299 6:52304845-52304867 CACAAGCAGGCACATGAAGATGG + Intergenic
1010391794 6:75346307-75346329 AACAAGGATGCCTAGGAAAATGG - Intronic
1010893933 6:81343924-81343946 CACATGGACGCGCATGAAAGTGG - Intergenic
1011254245 6:85404701-85404723 CACACGGACGCGCATGACAGAGG + Intergenic
1011668443 6:89658650-89658672 GACAAGGAAGCCGATGAAGAAGG - Exonic
1011961888 6:93101025-93101047 AACAAGGAAGCCCATGAGACTGG + Intergenic
1015267239 6:131301180-131301202 CACACGGACGCGCATGAAACCGG + Intergenic
1015402654 6:132803627-132803649 GACTAGGACGCCCAGTAAAATGG + Intergenic
1015786144 6:136922772-136922794 CACCAGGACGCCGATGAGCATGG - Exonic
1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG + Intergenic
1016249400 6:142021766-142021788 CACACGGACGCGCATGAAACAGG + Intergenic
1016535263 6:145103180-145103202 CACAGGGGCGTGCATGAAAATGG - Intergenic
1018218001 6:161549686-161549708 CACAAAGAAGACCTTGAAAATGG - Intronic
1018442543 6:163826296-163826318 CACACAGATGCCCCTGAAAACGG - Intergenic
1018572553 6:165226155-165226177 GACAAGGACTCCCATGAGCATGG - Intergenic
1019106782 6:169674734-169674756 CACATGGACGCGCATGAAAGAGG - Intronic
1020316476 7:6908976-6908998 CACATGGATGCGCATGAAACTGG + Intergenic
1020532052 7:9350432-9350454 CACAAGAAAGGCCATGAAAATGG + Intergenic
1029463908 7:100713211-100713233 CAGAAGGAAGCCTGTGAAAATGG + Intergenic
1031378004 7:121050902-121050924 CACCAGGATGCCCAAGAAGAAGG + Intronic
1031776812 7:125915723-125915745 CACAGGGAAGCGCATGAAAGTGG + Intergenic
1036373914 8:8183844-8183866 CACACGGACGCGCCAGAAAAAGG + Intergenic
1036876989 8:12481797-12481819 CACACGGACGCGCCAGAAAAAGG - Intergenic
1038429486 8:27488480-27488502 GAGAAGCACGACCATGAAAAAGG + Intergenic
1039060827 8:33570933-33570955 CACTTGGAGGCCCATGAAAGAGG - Intergenic
1039251746 8:35673443-35673465 CACTAAGACGCCTAAGAAAATGG + Intronic
1039575115 8:38616940-38616962 CATAAGGATGCCCATTAGAATGG - Intergenic
1049523702 8:143109210-143109232 CACAAGGATGACAATCAAAAGGG + Intergenic
1050126351 9:2360136-2360158 CAAAAGGATGCCAATGACAAAGG + Intergenic
1052305333 9:27002282-27002304 CACATGGACCCGCATGAAAGTGG - Intronic
1053017059 9:34667873-34667895 CACAAGGAAGCCCCTAAAACAGG - Intergenic
1055810551 9:80143132-80143154 CACACGGACACGCATGAAACTGG + Intergenic
1059862973 9:118485627-118485649 CACACGGACGCGCATGAAACTGG - Intergenic
1060737343 9:126074444-126074466 CACACGGACGCACATGAAAGTGG - Intergenic
1189315198 X:40050401-40050423 CACAAGGACCCAGATGAATAAGG + Intronic
1190925399 X:54899219-54899241 CACATGGACGCCCATGAAAAAGG + Intergenic
1195904397 X:109829486-109829508 CACACCGACGCGCATGAAAGTGG + Intergenic
1198955863 X:142129645-142129667 CAGAATAACGCCCATGAATAAGG + Intergenic
1199999537 X:153051259-153051281 CACAATGAGGCAAATGAAAAGGG + Intergenic