ID: 980389691

View in Genome Browser
Species Human (GRCh38)
Location 4:132126991-132127013
Sequence GTGTTTATGAATAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980389691_980389696 30 Left 980389691 4:132126991-132127013 CCTCTTTCCCTATTCATAAACAC No data
Right 980389696 4:132127044-132127066 AGACCTATGAAATTATTTTCAGG No data
980389691_980389695 6 Left 980389691 4:132126991-132127013 CCTCTTTCCCTATTCATAAACAC No data
Right 980389695 4:132127020-132127042 TCTCTATTTGAAATTATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980389691 Original CRISPR GTGTTTATGAATAGGGAAAG AGG (reversed) Intergenic
No off target data available for this crispr