ID: 980402930

View in Genome Browser
Species Human (GRCh38)
Location 4:132316063-132316085
Sequence GGGGACCCCTTGGGAAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980402921_980402930 10 Left 980402921 4:132316030-132316052 CCTTGCCAGTAACTCAGGTTTCA No data
Right 980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG No data
980402918_980402930 20 Left 980402918 4:132316020-132316042 CCCATTTCATCCTTGCCAGTAAC No data
Right 980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG No data
980402922_980402930 5 Left 980402922 4:132316035-132316057 CCAGTAACTCAGGTTTCAAGTTT No data
Right 980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG No data
980402919_980402930 19 Left 980402919 4:132316021-132316043 CCATTTCATCCTTGCCAGTAACT No data
Right 980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG No data
980402917_980402930 23 Left 980402917 4:132316017-132316039 CCTCCCATTTCATCCTTGCCAGT No data
Right 980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980402930 Original CRISPR GGGGACCCCTTGGGAAAGAG GGG Intergenic
No off target data available for this crispr