ID: 980403153

View in Genome Browser
Species Human (GRCh38)
Location 4:132320162-132320184
Sequence GGGGATGAACAGATGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980403147_980403153 20 Left 980403147 4:132320119-132320141 CCTCACATCAAATTTTCAATTAG No data
Right 980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980403153 Original CRISPR GGGGATGAACAGATGGATCT GGG Intergenic
No off target data available for this crispr