ID: 980405890

View in Genome Browser
Species Human (GRCh38)
Location 4:132353783-132353805
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980405890_980405894 15 Left 980405890 4:132353783-132353805 CCAGTAACAGGCCAAAAGCTGTC No data
Right 980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
980405890_980405893 11 Left 980405890 4:132353783-132353805 CCAGTAACAGGCCAAAAGCTGTC No data
Right 980405893 4:132353817-132353839 AAGTAGTTATCTGCAGAAGATGG No data
980405890_980405895 16 Left 980405890 4:132353783-132353805 CCAGTAACAGGCCAAAAGCTGTC No data
Right 980405895 4:132353822-132353844 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980405890 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr