ID: 980406018

View in Genome Browser
Species Human (GRCh38)
Location 4:132354805-132354827
Sequence TCACATTTCTTGAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980406018_980406019 7 Left 980406018 4:132354805-132354827 CCACAATCACTCAAGAAATGTGA No data
Right 980406019 4:132354835-132354857 TTTTGATTTTCTACTTTTCTAGG No data
980406018_980406020 13 Left 980406018 4:132354805-132354827 CCACAATCACTCAAGAAATGTGA No data
Right 980406020 4:132354841-132354863 TTTTCTACTTTTCTAGGTAGAGG No data
980406018_980406021 25 Left 980406018 4:132354805-132354827 CCACAATCACTCAAGAAATGTGA No data
Right 980406021 4:132354853-132354875 CTAGGTAGAGGCAGCTCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980406018 Original CRISPR TCACATTTCTTGAGTGATTG TGG (reversed) Intergenic
No off target data available for this crispr