ID: 980406020

View in Genome Browser
Species Human (GRCh38)
Location 4:132354841-132354863
Sequence TTTTCTACTTTTCTAGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980406018_980406020 13 Left 980406018 4:132354805-132354827 CCACAATCACTCAAGAAATGTGA No data
Right 980406020 4:132354841-132354863 TTTTCTACTTTTCTAGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980406020 Original CRISPR TTTTCTACTTTTCTAGGTAG AGG Intergenic
No off target data available for this crispr