ID: 980406021

View in Genome Browser
Species Human (GRCh38)
Location 4:132354853-132354875
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980406018_980406021 25 Left 980406018 4:132354805-132354827 CCACAATCACTCAAGAAATGTGA No data
Right 980406021 4:132354853-132354875 CTAGGTAGAGGCAGCTCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type