ID: 980418175

View in Genome Browser
Species Human (GRCh38)
Location 4:132520699-132520721
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980418175_980418181 13 Left 980418175 4:132520699-132520721 CCCAGTTTATGATGTTTTGATGG No data
Right 980418181 4:132520735-132520757 AATGGTAACTTGATTGCCTATGG No data
980418175_980418179 -5 Left 980418175 4:132520699-132520721 CCCAGTTTATGATGTTTTGATGG No data
Right 980418179 4:132520717-132520739 GATGGGCAGCTCAGTTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980418175 Original CRISPR CCATCAAAACATCATAAACT GGG (reversed) Intergenic
No off target data available for this crispr