ID: 980419220

View in Genome Browser
Species Human (GRCh38)
Location 4:132539426-132539448
Sequence CAGTGAAGGCCTTCAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980419218_980419220 -6 Left 980419218 4:132539409-132539431 CCGTTTTAGATTAATCACAGTGA No data
Right 980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980419220 Original CRISPR CAGTGAAGGCCTTCAGAATT TGG Intergenic
No off target data available for this crispr