ID: 980420692

View in Genome Browser
Species Human (GRCh38)
Location 4:132556322-132556344
Sequence CTGTGTGAGGGGAAAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980420686_980420692 22 Left 980420686 4:132556277-132556299 CCATTCAATAAATGTCATCCTTT No data
Right 980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG No data
980420687_980420692 4 Left 980420687 4:132556295-132556317 CCTTTGAAAGAGAAGTTCACCGC No data
Right 980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980420692 Original CRISPR CTGTGTGAGGGGAAAGTGCC AGG Intergenic
No off target data available for this crispr