ID: 980423896

View in Genome Browser
Species Human (GRCh38)
Location 4:132600035-132600057
Sequence CTGCTGGGACAGATGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980423896_980423905 18 Left 980423896 4:132600035-132600057 CCAACCTCCATCTGTCCCAGCAG No data
Right 980423905 4:132600076-132600098 GGCTGGACCTTTCCTGCTCCAGG No data
980423896_980423902 -6 Left 980423896 4:132600035-132600057 CCAACCTCCATCTGTCCCAGCAG No data
Right 980423902 4:132600052-132600074 CAGCAGAGTCAGCTAAGGAATGG No data
980423896_980423903 -3 Left 980423896 4:132600035-132600057 CCAACCTCCATCTGTCCCAGCAG No data
Right 980423903 4:132600055-132600077 CAGAGTCAGCTAAGGAATGGTGG No data
980423896_980423904 1 Left 980423896 4:132600035-132600057 CCAACCTCCATCTGTCCCAGCAG No data
Right 980423904 4:132600059-132600081 GTCAGCTAAGGAATGGTGGCTGG No data
980423896_980423906 21 Left 980423896 4:132600035-132600057 CCAACCTCCATCTGTCCCAGCAG No data
Right 980423906 4:132600079-132600101 TGGACCTTTCCTGCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980423896 Original CRISPR CTGCTGGGACAGATGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr