ID: 980429872

View in Genome Browser
Species Human (GRCh38)
Location 4:132680323-132680345
Sequence CAGGGTATGAAGACTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980429867_980429872 5 Left 980429867 4:132680295-132680317 CCCTTAGATTCTCAGGGATGGAA No data
Right 980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG No data
980429868_980429872 4 Left 980429868 4:132680296-132680318 CCTTAGATTCTCAGGGATGGAAA No data
Right 980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980429872 Original CRISPR CAGGGTATGAAGACTGATTC TGG Intergenic
No off target data available for this crispr