ID: 980431833

View in Genome Browser
Species Human (GRCh38)
Location 4:132710340-132710362
Sequence ATAGTTCATCAGTTCGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980431833_980431834 0 Left 980431833 4:132710340-132710362 CCTCTAGCGAACTGATGAACTAT No data
Right 980431834 4:132710363-132710385 AATAATTTATTTTATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980431833 Original CRISPR ATAGTTCATCAGTTCGCTAG AGG (reversed) Intergenic
No off target data available for this crispr