ID: 980437501

View in Genome Browser
Species Human (GRCh38)
Location 4:132797439-132797461
Sequence TCTGATTAGCACTTTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980437501_980437503 18 Left 980437501 4:132797439-132797461 CCTGAAAAAAAGTGCTAATCAGA No data
Right 980437503 4:132797480-132797502 ACAGTGAAAAACAAATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980437501 Original CRISPR TCTGATTAGCACTTTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr