ID: 980442301

View in Genome Browser
Species Human (GRCh38)
Location 4:132865188-132865210
Sequence CAAAAGCTGGCCTGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980442301_980442305 3 Left 980442301 4:132865188-132865210 CCACTGCGCCAGGCCAGCTTTTG No data
Right 980442305 4:132865214-132865236 TCTTAACAAAGAAAGGTCTCTGG No data
980442301_980442304 -4 Left 980442301 4:132865188-132865210 CCACTGCGCCAGGCCAGCTTTTG No data
Right 980442304 4:132865207-132865229 TTTGTTATCTTAACAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980442301 Original CRISPR CAAAAGCTGGCCTGGCGCAG TGG (reversed) Intergenic