ID: 980442304

View in Genome Browser
Species Human (GRCh38)
Location 4:132865207-132865229
Sequence TTTGTTATCTTAACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980442301_980442304 -4 Left 980442301 4:132865188-132865210 CCACTGCGCCAGGCCAGCTTTTG No data
Right 980442304 4:132865207-132865229 TTTGTTATCTTAACAAAGAAAGG No data
980442297_980442304 27 Left 980442297 4:132865157-132865179 CCTCCCAAAGTGCTGGGATTACA No data
Right 980442304 4:132865207-132865229 TTTGTTATCTTAACAAAGAAAGG No data
980442299_980442304 23 Left 980442299 4:132865161-132865183 CCAAAGTGCTGGGATTACAAGCA No data
Right 980442304 4:132865207-132865229 TTTGTTATCTTAACAAAGAAAGG No data
980442298_980442304 24 Left 980442298 4:132865160-132865182 CCCAAAGTGCTGGGATTACAAGC No data
Right 980442304 4:132865207-132865229 TTTGTTATCTTAACAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980442304 Original CRISPR TTTGTTATCTTAACAAAGAA AGG Intergenic