ID: 980442305

View in Genome Browser
Species Human (GRCh38)
Location 4:132865214-132865236
Sequence TCTTAACAAAGAAAGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980442299_980442305 30 Left 980442299 4:132865161-132865183 CCAAAGTGCTGGGATTACAAGCA No data
Right 980442305 4:132865214-132865236 TCTTAACAAAGAAAGGTCTCTGG No data
980442302_980442305 -5 Left 980442302 4:132865196-132865218 CCAGGCCAGCTTTTGTTATCTTA No data
Right 980442305 4:132865214-132865236 TCTTAACAAAGAAAGGTCTCTGG No data
980442301_980442305 3 Left 980442301 4:132865188-132865210 CCACTGCGCCAGGCCAGCTTTTG No data
Right 980442305 4:132865214-132865236 TCTTAACAAAGAAAGGTCTCTGG No data
980442303_980442305 -10 Left 980442303 4:132865201-132865223 CCAGCTTTTGTTATCTTAACAAA No data
Right 980442305 4:132865214-132865236 TCTTAACAAAGAAAGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980442305 Original CRISPR TCTTAACAAAGAAAGGTCTC TGG Intergenic