ID: 980459316

View in Genome Browser
Species Human (GRCh38)
Location 4:133085484-133085506
Sequence TTGAACTAGCATGAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980459309_980459316 13 Left 980459309 4:133085448-133085470 CCCTGAAATGTGCTCATAAAGAT No data
Right 980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG No data
980459308_980459316 23 Left 980459308 4:133085438-133085460 CCTTAGAAGTCCCTGAAATGTGC No data
Right 980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG No data
980459310_980459316 12 Left 980459310 4:133085449-133085471 CCTGAAATGTGCTCATAAAGATG No data
Right 980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980459316 Original CRISPR TTGAACTAGCATGAGGTGGT AGG Intergenic
No off target data available for this crispr