ID: 980461474

View in Genome Browser
Species Human (GRCh38)
Location 4:133120662-133120684
Sequence ATGTACTAGATGAGTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980461474_980461477 9 Left 980461474 4:133120662-133120684 CCTTTTTCACTCATCTAGTACAT No data
Right 980461477 4:133120694-133120716 AGCAAACAAGAGGCCGGACATGG No data
980461474_980461476 3 Left 980461474 4:133120662-133120684 CCTTTTTCACTCATCTAGTACAT No data
Right 980461476 4:133120688-133120710 CTAAAGAGCAAACAAGAGGCCGG No data
980461474_980461478 12 Left 980461474 4:133120662-133120684 CCTTTTTCACTCATCTAGTACAT No data
Right 980461478 4:133120697-133120719 AAACAAGAGGCCGGACATGGTGG No data
980461474_980461475 -1 Left 980461474 4:133120662-133120684 CCTTTTTCACTCATCTAGTACAT No data
Right 980461475 4:133120684-133120706 TGTGCTAAAGAGCAAACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980461474 Original CRISPR ATGTACTAGATGAGTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr