ID: 980463073

View in Genome Browser
Species Human (GRCh38)
Location 4:133143191-133143213
Sequence TTGGTATTCTCCATCTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980463073_980463075 2 Left 980463073 4:133143191-133143213 CCTATATAGATGGAGAATACCAA No data
Right 980463075 4:133143216-133143238 ATAATTTACATAACAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980463073 Original CRISPR TTGGTATTCTCCATCTATAT AGG (reversed) Intergenic
No off target data available for this crispr