ID: 980467374

View in Genome Browser
Species Human (GRCh38)
Location 4:133203377-133203399
Sequence ACCTTTATGATAATTATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980467374_980467378 -5 Left 980467374 4:133203377-133203399 CCTCAAATAATTATCATAAAGGT 0: 1
1: 0
2: 6
3: 29
4: 375
Right 980467378 4:133203395-133203417 AAGGTTAGGGGCCTTTTCCAAGG No data
980467374_980467379 1 Left 980467374 4:133203377-133203399 CCTCAAATAATTATCATAAAGGT 0: 1
1: 0
2: 6
3: 29
4: 375
Right 980467379 4:133203401-133203423 AGGGGCCTTTTCCAAGGAAATGG No data
980467374_980467382 13 Left 980467374 4:133203377-133203399 CCTCAAATAATTATCATAAAGGT 0: 1
1: 0
2: 6
3: 29
4: 375
Right 980467382 4:133203413-133203435 CAAGGAAATGGTTGCATCATAGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980467374 Original CRISPR ACCTTTATGATAATTATTTG AGG (reversed) Intronic
900322463 1:2091936-2091958 ATCTTTATAAAAATTATTTAAGG + Intronic
901824678 1:11853307-11853329 GCCTTTCTGAGAATGATTTGTGG - Intergenic
903217395 1:21850949-21850971 ATCTTTAAGATAATTCTGTGAGG + Intronic
904019741 1:27453965-27453987 ACGTTTAAGATAGTTATTTCAGG - Intronic
904400410 1:30253140-30253162 AGTTTTATTATTATTATTTGAGG + Intergenic
907083923 1:51651296-51651318 GCCTTTGTCATAATTATCTGGGG + Intronic
908479061 1:64519020-64519042 CTCATTATGTTAATTATTTGAGG + Intronic
909046965 1:70722117-70722139 AACTTTATAATAACTCTTTGAGG - Intergenic
909819239 1:80039363-80039385 ACCTTTATTATCTTCATTTGGGG + Intergenic
910084209 1:83379547-83379569 ACATTTCTGATAATTAGTTAGGG - Intergenic
910154426 1:84197804-84197826 ACCTTGCTGAGAATTATTTCTGG - Exonic
910260276 1:85287516-85287538 ACATTTATAATAATGACTTGTGG + Intergenic
911926779 1:103842750-103842772 ATCTTTATTATCATTATTTTTGG - Intergenic
915477696 1:156162685-156162707 TCCTTAATGAGAATTAATTGGGG - Intronic
916369099 1:164069130-164069152 ACCTTGATGAAAATAATTGGAGG - Intergenic
916400600 1:164444268-164444290 TTCTATATGATCATTATTTGTGG - Intergenic
916568198 1:166000933-166000955 ACCTGTATTATAATTATTGAAGG + Intergenic
916697785 1:167257559-167257581 ACTTTTATTAAAACTATTTGAGG + Intronic
918495032 1:185125933-185125955 ACATATATGAGAATTATATGTGG + Intronic
918803542 1:189006605-189006627 ATTTTTAAAATAATTATTTGTGG + Intergenic
918823198 1:189286062-189286084 AAATTAATGATAAATATTTGAGG - Intergenic
919023505 1:192138690-192138712 ACCTTTTTGACAATCATTTAAGG + Intergenic
920407935 1:205733076-205733098 ACCTGTATTTTAATTATTAGAGG - Intronic
921230642 1:213066873-213066895 ACCTTTAGCTTAGTTATTTGGGG - Intronic
921867147 1:220097661-220097683 ACTTTTATAAGAATTATTGGGGG - Intronic
923234928 1:232023178-232023200 ATATTTATAATTATTATTTGTGG - Intronic
923308570 1:232711411-232711433 ACATTAATTATAATTCTTTGTGG + Intergenic
923601812 1:235410246-235410268 TCCTTTATTATAATTTTTTTTGG - Intronic
923646999 1:235833704-235833726 AACTTTGTTAAAATTATTTGTGG - Intronic
924275882 1:242386282-242386304 ACCTCTAAGGTAATTATTTTGGG - Intronic
1063621559 10:7653843-7653865 ACTCTTATAACAATTATTTGAGG - Intronic
1063722995 10:8603333-8603355 TTCTTTATTATAATTGTTTGAGG + Intergenic
1064283683 10:13973252-13973274 ACCCTTAGGATAAAAATTTGTGG + Intronic
1064842275 10:19606920-19606942 AATTTTAGGATAATTATTTTAGG + Intronic
1064949580 10:20833477-20833499 ATTTTTATTATTATTATTTGGGG + Intronic
1065399036 10:25275238-25275260 ACCTTTATCACAATCATCTGGGG + Intronic
1065459044 10:25936064-25936086 TCCTTTAAAATTATTATTTGGGG + Intronic
1066211454 10:33243269-33243291 AACACTATGATAATTATGTGAGG - Intronic
1067124994 10:43508216-43508238 ACCCTGATGATAATGATTTGAGG + Intergenic
1068564320 10:58555121-58555143 AGATCTAGGATAATTATTTGGGG + Intronic
1069039115 10:63676076-63676098 ACTAATATGAAAATTATTTGGGG + Intergenic
1070253719 10:74796082-74796104 ACCTTTTTCATGTTTATTTGTGG + Intergenic
1070274374 10:74991156-74991178 CCTTTTATGATAATTATTGATGG + Intronic
1070431390 10:76342370-76342392 AGATTTAAGATAATTATTAGAGG + Intronic
1073069127 10:100782262-100782284 CCCTTTATGCTCATTGTTTGAGG - Intronic
1074463494 10:113660838-113660860 AACTTTAGGATATTTATTAGTGG - Intronic
1074726394 10:116314559-116314581 ACTTTTATGAGAATTCTATGTGG + Intergenic
1075062065 10:119263969-119263991 ACCTTGTTGATAACTAATTGTGG + Intronic
1077458532 11:2695896-2695918 ACCTTTTTCTTAATGATTTGTGG + Intronic
1077661489 11:4072411-4072433 AGTTTCAAGATAATTATTTGAGG + Intronic
1078353400 11:10614259-10614281 TCCTTCATGAGAATCATTTGTGG + Intronic
1078765775 11:14296439-14296461 ACTTTTTTCATAATTATTTAAGG + Intronic
1079378319 11:19914411-19914433 ACTTTTCTGAGAATGATTTGGGG - Intronic
1079605838 11:22365285-22365307 ACCATTCTAATAATTATTTATGG + Intronic
1079736483 11:24003149-24003171 ACCCTGATTTTAATTATTTGGGG - Intergenic
1080196039 11:29610179-29610201 AACTTTATGATAATTCTTTGAGG + Intergenic
1081957023 11:47102081-47102103 ACTTTTAGGAGAATGATTTGGGG + Intronic
1086955110 11:92927452-92927474 TCCTTTATGTTATTTATTTTTGG - Intergenic
1088418955 11:109621171-109621193 ACCTAAATGATAAATATTTATGG + Intergenic
1088525838 11:110753405-110753427 ACGTTTGTAATACTTATTTGAGG - Intergenic
1088615334 11:111621376-111621398 TCCTTTACTATAATTATTTTGGG + Intronic
1089379685 11:118019163-118019185 AACTTTATGAAAATTATGTTAGG + Intergenic
1089400913 11:118164161-118164183 ACATTTAGGGGAATTATTTGCGG - Exonic
1089650989 11:119912784-119912806 ATCTTTATTATTATTATTTTTGG - Intergenic
1093052471 12:14519009-14519031 AGTTTTATAATTATTATTTGTGG - Intronic
1093658808 12:21729203-21729225 ATCTTTATGATGATTATTTCTGG + Intronic
1094318790 12:29161974-29161996 ATCTTTTTCATAGTTATTTGTGG + Intronic
1094733922 12:33210468-33210490 ACCTTACTGATAATTTTCTGGGG + Intergenic
1095347089 12:41163553-41163575 GATTTTATTATAATTATTTGTGG + Intergenic
1095379963 12:41579148-41579170 ACCATAATGCTGATTATTTGGGG + Intergenic
1095443597 12:42262302-42262324 AGCTTTATAATAATAATTTGTGG + Intronic
1096821194 12:54236300-54236322 ACCAGTATGAAAGTTATTTGAGG + Exonic
1097690894 12:62733597-62733619 ATCTTTATGGTAAATACTTGAGG - Intronic
1098332636 12:69370040-69370062 ACTTTTTAGAAAATTATTTGGGG + Intronic
1099126489 12:78764782-78764804 GACTTTATGATAGTTTTTTGGGG - Intergenic
1099856457 12:88174062-88174084 AACTTTAGGTTAATTATTTGAGG - Intronic
1100736352 12:97538147-97538169 ACCTTTATTATTATTTTTGGGGG - Intergenic
1101559505 12:105842784-105842806 ATTTTTATGATAATTATTATAGG - Intergenic
1102345777 12:112160428-112160450 ATATTTATTATAATTATTTATGG - Exonic
1104542913 12:129684107-129684129 ATTATTATTATAATTATTTGGGG - Intronic
1105697774 13:22906961-22906983 ACTTCAAAGATAATTATTTGTGG - Intergenic
1105830405 13:24159381-24159403 AGATTAATGATAATTATCTGTGG - Intronic
1106441276 13:29774404-29774426 ACCTTTATGAGATTTTTTTTGGG - Intronic
1106639936 13:31573332-31573354 ACCATTATGCAAATCATTTGGGG - Intergenic
1107862616 13:44675092-44675114 ACCTTTATGATCATACTGTGTGG + Intergenic
1107919621 13:45190597-45190619 ACCTTTCTTAGAATTGTTTGAGG + Intronic
1109479002 13:62923508-62923530 ACCATTATGATATCTAATTGTGG + Intergenic
1110118264 13:71847046-71847068 ACCTTTATTATTATTAATTAAGG - Intronic
1110680178 13:78301413-78301435 ACATTTATGGCAATTATTTTAGG - Intergenic
1111147363 13:84201380-84201402 CCCTTTATTATTATTTTTTGGGG - Intergenic
1111353408 13:87063618-87063640 ACCTTCATGAGTATAATTTGAGG - Intergenic
1111482095 13:88843028-88843050 CCCATTAAAATAATTATTTGAGG + Intergenic
1111687998 13:91525561-91525583 CTCTTTCTGACAATTATTTGTGG + Intronic
1111722651 13:91965829-91965851 AACTTCATGATAATTATATTAGG - Intronic
1111788505 13:92822121-92822143 ACCTTTGTAATAATTATTTGAGG - Intronic
1111834089 13:93365663-93365685 AAATTTATCATAATTATTTTAGG + Intronic
1111944702 13:94652516-94652538 ATGTTTATGATAATTTTTTAAGG + Intergenic
1112280449 13:98058444-98058466 ACCTAAAATATAATTATTTGGGG - Intergenic
1112418065 13:99221205-99221227 ACATTTATGATAATTACTTTGGG + Intronic
1113119956 13:106915649-106915671 ACCTGTAGGAGAATTACTTGGGG - Intergenic
1113893135 13:113747102-113747124 ACATTTCTGAAAATTCTTTGAGG - Intergenic
1114783588 14:25569224-25569246 ACTTTGAGGAAAATTATTTGAGG - Intergenic
1116051766 14:39812635-39812657 AACTTTATTACAAGTATTTGAGG - Intergenic
1116103665 14:40472948-40472970 ATCTTTAAGATAATTCTTTTTGG - Intergenic
1116144162 14:41042100-41042122 TCCATTATTATTATTATTTGTGG - Intergenic
1116194610 14:41707109-41707131 AACTATATTGTAATTATTTGTGG - Intronic
1116409533 14:44605423-44605445 ACCTTTTGGATATTTATTTTTGG - Intergenic
1116433739 14:44874401-44874423 ACTTTGATGATATCTATTTGAGG + Intergenic
1118238491 14:64033846-64033868 AAACTTATGAAAATTATTTGAGG - Intronic
1118452370 14:65915468-65915490 AACTCTCTGTTAATTATTTGAGG - Intergenic
1120085376 14:80266451-80266473 ACATTTATGATAATTACATTTGG + Intronic
1120416868 14:84230462-84230484 ACCTTTTTTCTAATTAATTGGGG + Intergenic
1120505054 14:85345488-85345510 ATCTTTATAATTATTATTTTAGG - Intergenic
1120767232 14:88339684-88339706 ACATTTATCATTATTTTTTGTGG - Intergenic
1121186081 14:91970904-91970926 TTCTTTATTGTAATTATTTGGGG - Intronic
1121388721 14:93555764-93555786 ACCTCACTGATAATTATTTAGGG - Intronic
1123802197 15:23832903-23832925 ACCATTATTTCAATTATTTGGGG + Intergenic
1123972560 15:25521999-25522021 TTCTTTATGATTATTTTTTGAGG - Intergenic
1124190596 15:27573399-27573421 ACCTTTAAGATTAATATTTAGGG + Intergenic
1124954362 15:34350388-34350410 CCCTTTCTAATAATTAATTGAGG + Intronic
1125173650 15:36795310-36795332 ATCAAAATGATAATTATTTGAGG + Intronic
1126271402 15:46821931-46821953 AACATTATTATAATTATCTGTGG - Intergenic
1126318141 15:47392723-47392745 AACTTTGTGATAATTTTTTATGG + Intronic
1126414460 15:48403680-48403702 ATTTTTATGATATTTATATGTGG - Intergenic
1126462980 15:48933026-48933048 GCCTTTATGATTATTCTTTTGGG - Intronic
1127414067 15:58739692-58739714 ACCTTTATAATACACATTTGAGG + Intronic
1127929222 15:63580388-63580410 ACCTTTATAATACCTATTTGGGG + Intronic
1128003348 15:64215134-64215156 GCTTTTATGATTATTATTTTTGG - Intronic
1129571830 15:76695293-76695315 TCCTTTATAAAAATTATTTGTGG + Intronic
1129572008 15:76697938-76697960 TCCTTTATAAAAATTATTTGTGG - Intronic
1131737721 15:95351659-95351681 ATCATTATTATTATTATTTGAGG - Intergenic
1135801003 16:25495533-25495555 ACCTTCATGAGAATTCTATGTGG - Intergenic
1135941391 16:26825063-26825085 ATTTTTATGTTTATTATTTGGGG + Intergenic
1137781007 16:51097839-51097861 ACCTTTAAACAAATTATTTGTGG + Intergenic
1138671126 16:58615573-58615595 TCCTCAATGAAAATTATTTGAGG + Intronic
1139122699 16:64040381-64040403 ATTTTTATGATAATTTTCTGGGG + Intergenic
1140312718 16:73865211-73865233 AACTTTATGATTGTTGTTTGGGG + Intergenic
1141010846 16:80396939-80396961 TCCTATATGAAAATCATTTGTGG - Intergenic
1141870194 16:86779987-86780009 AACTTTAAAATAATAATTTGAGG - Intergenic
1142942126 17:3388578-3388600 ACCATTAAAATAAATATTTGAGG + Intergenic
1143748134 17:9008633-9008655 AACTTTATGAAAATTGTTTAGGG + Intergenic
1143987594 17:10928475-10928497 ACCCTTAATATAATCATTTGGGG - Intergenic
1144180576 17:12747700-12747722 ACCTTTCTGATTACTATTAGCGG - Intronic
1144443618 17:15306390-15306412 ATCTTTAGGATTATTATTGGGGG - Intronic
1149241372 17:54653965-54653987 AACTATATGATAATTAATTCAGG - Intergenic
1150503269 17:65671771-65671793 ACCTTCATTCTAATTACTTGTGG - Intronic
1151072751 17:71234856-71234878 ACCTTTATGATAGCTATAAGAGG - Intergenic
1152118421 17:78403227-78403249 ACCTTTGGGATAATTCCTTGGGG - Intronic
1152888357 17:82865717-82865739 AACTATATGATGATTTTTTGTGG + Intronic
1153249822 18:3110039-3110061 TCCTTTATTATCATTTTTTGTGG - Intronic
1154040843 18:10854403-10854425 ACCTTTATAGTAATTATTTCAGG + Intronic
1155741195 18:29290301-29290323 ACTATTGTAATAATTATTTGAGG + Intergenic
1155767069 18:29649243-29649265 AAATTTATGATAATTTTTTATGG - Intergenic
1155801709 18:30113778-30113800 AACTTTAATATATTTATTTGAGG + Intergenic
1156571619 18:38261240-38261262 ATCTTTTTGATAATTTTTGGAGG + Intergenic
1156774399 18:40769770-40769792 ACCTTTATGATATGCTTTTGTGG + Intergenic
1158483084 18:57839510-57839532 ACCTTTCTGATAGGTAGTTGTGG + Intergenic
1158803206 18:60937735-60937757 ACCTTTATTATTATTTTTTTTGG + Intergenic
1158838033 18:61352444-61352466 CCCTCTATGATAACTATTTGTGG + Intronic
1159032625 18:63246921-63246943 ACCTAGATGATCATTAATTGAGG - Intronic
1159187655 18:64998074-64998096 ACCTTTATCAAAATGACTTGAGG + Intergenic
1159190955 18:65041338-65041360 ACATTCATGATGAATATTTGTGG + Intergenic
1159292829 18:66444525-66444547 ACCTTTGTGATGATGATCTGTGG + Intergenic
1159504510 18:69317517-69317539 TCCTTTAAGATAAATATTTCTGG + Intergenic
1159526223 18:69593904-69593926 ATCTTAATGAAAATTATGTGTGG - Intronic
1159537554 18:69734777-69734799 TACTTTAAGATAATTTTTTGTGG - Intronic
1160352155 18:78192898-78192920 TCCTAAATTATAATTATTTGAGG - Intergenic
1162459620 19:10806792-10806814 ATCTTTATTATTATTATTTTTGG - Intronic
1162883689 19:13680061-13680083 ACCTATAAAGTAATTATTTGAGG + Intergenic
1162929052 19:13947077-13947099 ACCTTTATAATAATTGTTGTAGG + Intronic
1163049493 19:14671460-14671482 ACCTTTGTGATTATTATATTAGG + Intronic
1164362027 19:27523636-27523658 TCCTTTCTAATATTTATTTGTGG - Intergenic
1164953738 19:32362545-32362567 ACCTTTTTCCTAAGTATTTGAGG - Intronic
1165605017 19:37094682-37094704 ACCTTTGTGGCAATTAGTTGAGG + Intronic
1167725484 19:51210112-51210134 ACATTTCTGATAATTAAATGAGG - Intergenic
1167815152 19:51873914-51873936 ACATCCATGATAATTTTTTGTGG + Intronic
1168385017 19:55955932-55955954 AACTTTATGATAATCATTTAGGG - Exonic
925323788 2:2999477-2999499 ACTTTTAAGATAATTGTTTTAGG - Intergenic
925782594 2:7396006-7396028 ACTTTTATTTAAATTATTTGTGG + Intergenic
926495938 2:13588284-13588306 ACCTTTATTTTCTTTATTTGGGG + Intergenic
926608863 2:14925092-14925114 ACCTTTGTGAAAATTCCTTGGGG - Intergenic
927642461 2:24854015-24854037 TCCTTTATAAAAATTACTTGAGG + Intronic
927736436 2:25526694-25526716 CCCTTTAAGATATTTATTTATGG - Intronic
929236873 2:39614882-39614904 ACAGTTTTGATAAGTATTTGTGG - Intergenic
930225298 2:48786085-48786107 ATATTTAAGATAATCATTTGTGG + Intergenic
930283475 2:49399473-49399495 ACCTTTAGAATAAAAATTTGTGG - Intergenic
930353655 2:50290417-50290439 ACATTTTTGAAAGTTATTTGTGG + Intronic
930643064 2:53874258-53874280 CCCTTTTTAATAAGTATTTGCGG - Intronic
932916149 2:75860441-75860463 ACATTTATTAGAAATATTTGGGG - Intergenic
935379962 2:102441561-102441583 AGTTTTATGATAGCTATTTGCGG - Intronic
936703889 2:115046723-115046745 ACATTTAAGTTAATTATATGTGG - Intronic
937379237 2:121361579-121361601 AACATTATGAAAATTTTTTGTGG + Intronic
939218304 2:139268854-139268876 ACCTTTACTATAATTATTGAGGG - Intergenic
939372834 2:141324596-141324618 GCCTTTATGAAAAGTAATTGAGG - Intronic
940603524 2:155890815-155890837 AACTCTATGATAGTTTTTTGGGG + Intergenic
941332205 2:164192484-164192506 GTCTTTATTATAATTCTTTGTGG - Intergenic
941373197 2:164693613-164693635 TCCTTTATGGTAAATATTTAAGG + Intronic
942005019 2:171689246-171689268 ACTTTTAGTACAATTATTTGTGG - Intronic
942666136 2:178320648-178320670 TCCTTTAAGATCATAATTTGTGG - Intronic
945317137 2:208381667-208381689 CCTTTTATAGTAATTATTTGTGG + Intronic
946092960 2:217247210-217247232 ACATTTATTATCATTATTAGTGG + Intergenic
948289583 2:236815322-236815344 ACCATAAAGTTAATTATTTGGGG - Intergenic
1168798046 20:624976-624998 ACATTTATCTTAAATATTTGTGG - Intergenic
1170794016 20:19530993-19531015 ACCTTTAATATTATTATTTTGGG - Intronic
1170884354 20:20326826-20326848 AACTTTATAAAAATTATTTTTGG + Intronic
1171297481 20:24031138-24031160 AGCTTTATTCTAATGATTTGAGG + Intergenic
1171424659 20:25042061-25042083 ACCTTTCTGAGAATTCTCTGGGG - Intronic
1171874838 20:30564651-30564673 ACGTTTATGTTAAATATGTGAGG + Intergenic
1173631205 20:44517044-44517066 CACTTTATGATAATTTTGTGTGG + Intronic
1173745704 20:45435282-45435304 ACATAAATGATACTTATTTGTGG - Intergenic
1173775059 20:45698458-45698480 ACTTTTTTGATAGTCATTTGAGG - Intronic
1175006139 20:55685419-55685441 ACATTTATTAAAATTTTTTGTGG + Intergenic
1176694356 21:9957300-9957322 ACCTTTAGAATACTTATTTGAGG - Intergenic
1177189775 21:17838242-17838264 AGCTTTATTATTATTATTTAAGG + Intergenic
1177457460 21:21359606-21359628 AATTTTATGATAGTTGTTTGGGG + Intronic
1181419460 22:22787734-22787756 AACTTTTTGATAAATATTTAAGG + Intronic
1182142271 22:27970582-27970604 ACATTTTTGAGTATTATTTGAGG + Intergenic
1182177624 22:28307981-28308003 ACTTTTATAATGACTATTTGAGG + Intronic
949659665 3:6263609-6263631 TCATTTATGAAGATTATTTGAGG + Intergenic
949732403 3:7128898-7128920 AACTTTATGATAGTTTATTGAGG - Intronic
951669365 3:25163206-25163228 ACCTGAAAAATAATTATTTGTGG + Intergenic
952458921 3:33503725-33503747 GCCTTTATGTTAACTTTTTGAGG + Intronic
952850347 3:37723360-37723382 ATTTTTATTATTATTATTTGAGG + Intronic
952914856 3:38228430-38228452 ATCTTTATAATAATCATCTGAGG + Intronic
953144261 3:40259543-40259565 ACCTTTATGCTAATTATGATTGG + Exonic
953576772 3:44119113-44119135 ACCTTCATGTTAATTTTTTATGG + Intergenic
954644346 3:52121822-52121844 ATATTTTTGATAAATATTTGGGG - Intronic
956208809 3:66782157-66782179 TCTTGGATGATAATTATTTGTGG + Intergenic
956588839 3:70892155-70892177 ACCTACATGACAATTATTTTAGG - Intergenic
958154391 3:89735876-89735898 AGTTTTATAATAATTATGTGAGG + Intergenic
958702530 3:97612823-97612845 ATCTTTATAATAATTGTATGAGG - Intronic
958950975 3:100415547-100415569 ACCATTATGAGTATTTTTTGTGG + Intronic
959007080 3:101031918-101031940 ACCTTTATGAAAAGTTTATGAGG + Intergenic
959801885 3:110504876-110504898 TACTTTATTATTATTATTTGAGG - Intergenic
960128485 3:114026860-114026882 ACCTACATCTTAATTATTTGGGG - Intronic
960918360 3:122720802-122720824 TCGTTTATCATAATTATTTTGGG + Intronic
960919528 3:122732348-122732370 ACCTTTATGAAAAATATTTCAGG - Intergenic
962915248 3:139895489-139895511 ACCTGTGTGAGAATTACTTGGGG + Intergenic
963263483 3:143216046-143216068 ATTTTTATGATAATTCTCTGAGG + Intergenic
963549114 3:146698562-146698584 ACCTTTATTATTATTTTTTTTGG + Intergenic
963589222 3:147235371-147235393 ATCTTTATGATAATTCTATGAGG - Intergenic
963981286 3:151540089-151540111 TTCTTTATGACAATTAATTGAGG - Intergenic
964185587 3:153938866-153938888 ACCTTGGAGATAATTATTTTTGG - Intergenic
964590296 3:158354469-158354491 ACCTTTAAGTTCAATATTTGAGG - Intronic
965337579 3:167446366-167446388 CCTTTTTTGAGAATTATTTGGGG - Intronic
965468093 3:169057494-169057516 ACCTTTGTTAGAAATATTTGTGG - Intergenic
965473637 3:169127026-169127048 ACAATTATTAAAATTATTTGTGG + Intronic
966326883 3:178766493-178766515 ACATGTATGAAAAATATTTGTGG - Intronic
966530841 3:180977875-180977897 ACCTTAATCAGAATAATTTGAGG - Exonic
967116770 3:186348113-186348135 AACTTAATGATAATAATGTGGGG - Intronic
967438206 3:189476050-189476072 CTCTTTAGGATAATTATTTCTGG - Intergenic
968328061 3:197838542-197838564 ACCATTTTGATGATTATTTTTGG + Intronic
969861803 4:10041931-10041953 ACCATTATGATAATTATATTTGG + Intronic
970400586 4:15713494-15713516 ATCTTTATGACAATTCTGTGAGG + Intronic
971114865 4:23633429-23633451 AACTTTATTATATTTATATGTGG - Intergenic
971524851 4:27603948-27603970 GCATTTTTGATAATGATTTGAGG - Intergenic
971654737 4:29329694-29329716 ACCTTTATTATAATTCTCTAGGG - Intergenic
972287693 4:37664413-37664435 ACCTTTATGATAGTTATAGAGGG - Intronic
973140967 4:46767737-46767759 TCCTTTTTGATTATTCTTTGAGG - Intronic
974138950 4:57858386-57858408 AAATTTAAAATAATTATTTGTGG - Intergenic
975445168 4:74455671-74455693 ACCTTTATGATATGTGTATGGGG + Intergenic
975519567 4:75285874-75285896 ACTTTTACTTTAATTATTTGTGG + Intergenic
975689558 4:76950192-76950214 CCCTTTAAAATAATTCTTTGAGG + Intronic
976215950 4:82715578-82715600 ACCTGTATCATAATTTTCTGAGG + Intronic
976229730 4:82829156-82829178 ACCTTTGTGACAGTTATTTCAGG - Intronic
977328145 4:95603297-95603319 GGCTTTATGATAACCATTTGGGG - Intergenic
977355096 4:95935985-95936007 ACTTTTTTGTCAATTATTTGTGG - Intergenic
977744604 4:100530658-100530680 ACCTTTATGATAATTACTTTGGG - Intronic
977990635 4:103436842-103436864 ATCTATGTGATAATTATTTTTGG + Intergenic
978077555 4:104551949-104551971 TCTTATTTGATAATTATTTGAGG + Intergenic
978257150 4:106706044-106706066 ACCCTGATGTTAATCATTTGTGG + Intergenic
978366987 4:107992812-107992834 GCCTTTATAATAATTATCTTCGG + Intronic
978600617 4:110423740-110423762 ACCCTTAAGAAAATTTTTTGTGG + Intronic
978647337 4:110951758-110951780 ATATTTATGGTAATTATTTTTGG + Intergenic
979132353 4:117063224-117063246 AGCTTTCTGATAATTGTGTGGGG + Intergenic
980467374 4:133203377-133203399 ACCTTTATGATAATTATTTGAGG - Intronic
980467935 4:133209992-133210014 AAATTTATGTTAATTATTTCAGG - Intergenic
980645519 4:135637307-135637329 ACCTTTATTAGAATTATTTGAGG - Intergenic
980717631 4:136647846-136647868 ACTTTTTTGACATTTATTTGGGG + Intergenic
981071981 4:140551400-140551422 AACTTTATGTTAATGGTTTGTGG + Exonic
981515511 4:145604905-145604927 ATCTTTCTCATAATTTTTTGTGG + Intergenic
981571577 4:146157376-146157398 GCCATTAAGAAAATTATTTGAGG + Intergenic
982425549 4:155254357-155254379 ACCTTTAAGAGAGTCATTTGAGG - Intergenic
982534139 4:156587273-156587295 AACTTTATGAGATTTTTTTGTGG - Intergenic
983355719 4:166655108-166655130 ACCTTTATGACAATTATTTATGG - Intergenic
984570147 4:181382383-181382405 ACCAGTATGATAAATATCTGTGG + Intergenic
985422095 4:189794678-189794700 TGCTTTATTATAATTATTTTTGG - Intergenic
986743302 5:10722719-10722741 ACCTTAATGAAAACTATATGGGG + Intronic
988016370 5:25564896-25564918 ACCTCTTTTATAATTATGTGTGG + Intergenic
988125065 5:27021654-27021676 TCCTGTATGCTAATTATGTGTGG + Intronic
990576614 5:57129433-57129455 ACCTTTATAATAATTCTGTGAGG - Intergenic
990850204 5:60194592-60194614 CCCTTCATGATTATTATCTGGGG - Intronic
990851009 5:60204983-60205005 ATCTTTATTATTATTATCTGTGG + Intronic
990913122 5:60873796-60873818 ACCTTCATGATAATCACGTGTGG + Intergenic
991040076 5:62166430-62166452 AACTTTAGGATCATTATTTAAGG + Intergenic
993649169 5:90497383-90497405 AACCTTATGGTAATTATTTGTGG - Intronic
993865651 5:93191477-93191499 ACCTTTTTGATGAATATTGGTGG - Intergenic
995766225 5:115622703-115622725 AACTTTTTGATAATTACCTGTGG + Intronic
996185755 5:120473284-120473306 ATGTTTTTGATAAATATTTGGGG + Intronic
997024550 5:130042991-130043013 AGCTTTAGGATAACTATCTGAGG - Intronic
997876756 5:137556364-137556386 AAATTTATGATGAATATTTGTGG - Intronic
997961473 5:138325199-138325221 TCTTTTATGGTAATGATTTGGGG + Intronic
997988894 5:138527483-138527505 ACCTTTTTGATAATTCCTTCTGG + Intronic
999038612 5:148382510-148382532 ACATTTATTACAATGATTTGTGG + Intergenic
999430253 5:151519677-151519699 TGCTTTATAAAAATTATTTGAGG + Intronic
999930232 5:156424388-156424410 ACATTCATGATTGTTATTTGTGG - Intronic
1000178736 5:158786049-158786071 ATCTTTATCTTAATTATTAGTGG - Intronic
1000853108 5:166364305-166364327 ACGGTTATGAAAATTACTTGGGG + Intergenic
1001306625 5:170579360-170579382 ACCTTCATCATAACTATTTGGGG - Intronic
1003771884 6:9313841-9313863 ATCTTTATGATAATCCTGTGAGG + Intergenic
1003899931 6:10644984-10645006 ACATATCTGAAAATTATTTGTGG + Intergenic
1004297560 6:14427699-14427721 TCCTATTTGATAATAATTTGTGG - Intergenic
1005099206 6:22151551-22151573 ACCTTTACAATAAATGTTTGGGG - Intergenic
1005108734 6:22253919-22253941 AACACTATGGTAATTATTTGGGG - Intergenic
1005420972 6:25650738-25650760 ACCTTTATGATAATAACACGGGG + Intergenic
1005641063 6:27796819-27796841 CCCTTTATGTTAGTGATTTGGGG - Intergenic
1005791256 6:29303462-29303484 ACCGTTGTGATAGTTATTTGTGG + Intergenic
1008844639 6:55949075-55949097 ACCTTTAGTATAATTATTTTGGG + Intergenic
1010259380 6:73797936-73797958 ACCTTTAAGTTAATCATTTTAGG - Intronic
1011166867 6:84458319-84458341 ACCGTTATCATTATTATTAGAGG + Intergenic
1011989745 6:93499635-93499657 ACCTCTATTTTAATTTTTTGAGG - Intergenic
1012236767 6:96827002-96827024 AACTTTGTGGTAATTATTTCAGG - Intronic
1013314613 6:108929645-108929667 AATTTTATCATTATTATTTGTGG + Intronic
1013878636 6:114865965-114865987 AGCTTTATCAGAATTATTTATGG - Intergenic
1013920889 6:115402315-115402337 ACCTTTACTATAATTACTTTTGG + Intergenic
1014041462 6:116831902-116831924 ATCTTTATGAGAATTACTTGGGG - Intergenic
1020388162 7:7630599-7630621 TCCTTTATGCTAATGATTTGTGG - Intergenic
1020641316 7:10757660-10757682 GTATTTATGAAAATTATTTGGGG + Intergenic
1020664914 7:11028420-11028442 ACCATAATTAAAATTATTTGAGG - Intronic
1020772695 7:12415309-12415331 ACCTATATGTTTATTATTTTGGG + Intergenic
1022211484 7:28214500-28214522 ACCTTTATCTTAATTATCTTGGG - Intergenic
1022313930 7:29226760-29226782 TTCGTTATGTTAATTATTTGGGG - Intronic
1023070253 7:36423611-36423633 ACCTTGATGATGCTTATTTCAGG + Intronic
1023712034 7:43005316-43005338 ACTTTTGTGTTAATTTTTTGAGG + Intergenic
1024920754 7:54551658-54551680 AACTTTGTGACTATTATTTGAGG + Intronic
1025620898 7:63169829-63169851 ACCCTTAAGAAAATTTTTTGTGG + Intergenic
1025711768 7:63917609-63917631 CACTTTCTGATAAGTATTTGTGG + Intergenic
1025789242 7:64672353-64672375 ATTTTTATTATAATTATTTTTGG + Intronic
1026426581 7:70300597-70300619 ATCTTTTTGAGAATTTTTTGGGG + Intronic
1027344096 7:77239347-77239369 TCATTAATGAAAATTATTTGAGG + Intronic
1027969876 7:85065854-85065876 ACATTTATTTGAATTATTTGTGG - Intronic
1028284160 7:88974387-88974409 ACATAAATGATAATTATGTGAGG + Intronic
1028361569 7:89973383-89973405 ATTATTATTATAATTATTTGGGG - Intergenic
1028580211 7:92401999-92402021 ACGTAAATGATAAATATTTGAGG - Intergenic
1028754127 7:94415816-94415838 ACCTATGTGATAAATATTTTGGG + Intronic
1030641288 7:112009682-112009704 ACATTTATGAGGATTATTTGGGG + Intronic
1031622817 7:123955731-123955753 ACATTTATGAGAATTTTTTAAGG + Intronic
1032678839 7:134160616-134160638 ACTTTTATGATAAATATAAGGGG + Intronic
1032984091 7:137317685-137317707 ACTTAAATGATAATTATATGTGG + Intronic
1035322728 7:158044060-158044082 ACTTTTATGAAAATCATGTGTGG - Intronic
1035518323 8:255520-255542 ACCTTTCTGTTAATTGTTTGGGG - Intergenic
1035884860 8:3280823-3280845 CCCTTTATTATAATTATTTGAGG - Intronic
1035935885 8:3838007-3838029 TTATTTATGATAATTAGTTGGGG - Intronic
1036630375 8:10509473-10509495 TCCTTCAGGATACTTATTTGCGG + Intergenic
1037508802 8:19561083-19561105 ACTCTTTTGATAATTATTTATGG - Intronic
1037576004 8:20203542-20203564 AGCTTCATGTTAATTATTTTAGG + Intronic
1038475611 8:27864732-27864754 AACTTTATTATAATTAGTGGAGG - Intergenic
1038667543 8:29552874-29552896 AAGTTTATTATTATTATTTGAGG + Intergenic
1038820700 8:30949506-30949528 AGCTTAATGAAAATTATTTTTGG + Intergenic
1038900572 8:31839094-31839116 ACATCTATGATAATAATTTGAGG + Intronic
1038930600 8:32189383-32189405 GCCTTTATGGTAATTACTTATGG + Intronic
1039185609 8:34912614-34912636 TCCTTTATGGTAATTTTTTATGG - Intergenic
1039231467 8:35453461-35453483 ATCTAAATGATTATTATTTGAGG + Intronic
1039851587 8:41371041-41371063 ACCTTTATGCTAGTTAATAGTGG - Intergenic
1041421868 8:57675904-57675926 CCAATTATGATAATTATTAGAGG - Intergenic
1041753034 8:61282040-61282062 ACCTTTGTTCTAATTAGTTGTGG - Intronic
1042110791 8:65379323-65379345 AACTTTATGAAAGTTATTTATGG - Intergenic
1042621681 8:70712863-70712885 ACTTTTGTAAAAATTATTTGAGG - Intronic
1042651513 8:71047116-71047138 AGCTTTATGAGAATTATGCGTGG + Intergenic
1043026828 8:75080773-75080795 ACATTTATTATACTCATTTGTGG + Intergenic
1043380682 8:79698772-79698794 ACCCATATGATCATTTTTTGAGG + Intergenic
1043699428 8:83266991-83267013 AGCCTTATGATAATTATTTTTGG - Intergenic
1044058557 8:87603300-87603322 TCATTTAAGATTATTATTTGTGG - Intronic
1044153341 8:88811115-88811137 AACATTATGATAATCATATGAGG - Intergenic
1045095901 8:98798408-98798430 ACCTTTATGATGATATTCTGAGG - Intronic
1045098038 8:98818680-98818702 ACATTAATGATAATTAGTTTAGG - Intronic
1045795063 8:106033015-106033037 TCCTTTATCAAAATTTTTTGTGG - Intergenic
1045814365 8:106262144-106262166 ACCTTTATGATAACCATTAGAGG + Intergenic
1046015306 8:108597859-108597881 ACCTTTCTTATTATTTTTTGTGG + Intergenic
1046177506 8:110597458-110597480 ACCATTTTGATATTTATTTGTGG - Intergenic
1046685672 8:117223789-117223811 ACCTTCAAGATATTCATTTGTGG - Intergenic
1046873052 8:119224918-119224940 ACCTTAATGACAATTCTTTATGG + Intronic
1047916670 8:129591353-129591375 GCCTTTATTATTATTTTTTGAGG + Intergenic
1048562297 8:135553539-135553561 ACCTCAATGTTCATTATTTGAGG - Intronic
1049012108 8:139894128-139894150 CCCTTTATGAGAATTCTTAGAGG + Intronic
1051570424 9:18550746-18550768 ACGTTTATGATAAATGTTTATGG + Intronic
1051801782 9:20942805-20942827 ACTCTGATGAAAATTATTTGGGG - Intronic
1055153627 9:73034515-73034537 AGCCTCATGATAACTATTTGGGG - Intronic
1057044189 9:91872120-91872142 TTTTTTATTATAATTATTTGTGG - Intronic
1059800682 9:117746605-117746627 CCCTTTATTATTATTATCTGTGG + Intergenic
1186842024 X:13493950-13493972 AACTTTGTGATCATTATTTTTGG - Intergenic
1187996208 X:24929655-24929677 ACCAATATGAGAATTATTTGGGG - Intronic
1188946342 X:36308035-36308057 CCCTTCATCATAATTATTGGGGG + Intronic
1190944445 X:55077281-55077303 ACCTGTAGGCTAATTATTTCAGG - Intronic
1190964234 X:55282602-55282624 ACCTATAGGCTAATTATTTCAGG - Intronic
1191164286 X:57371059-57371081 AAATTTTTGATACTTATTTGTGG - Intronic
1191986498 X:66986585-66986607 AACTTTATATTAAATATTTGAGG + Intergenic
1192866582 X:75139756-75139778 ACATCTATGAGAATCATTTGAGG - Intronic
1193147865 X:78095864-78095886 AAATTTATTTTAATTATTTGGGG - Intronic
1194584581 X:95717030-95717052 ACCCTGATGATACTGATTTGAGG + Intergenic
1195116412 X:101703276-101703298 AGCTTTATTTTAATTTTTTGAGG - Intergenic
1195879968 X:109582689-109582711 ATCTGTATGATACTTATTTTGGG - Intergenic
1196119120 X:112029538-112029560 ACCTTTATTTTAGTTTTTTGAGG + Intronic
1196155810 X:112428469-112428491 ACCTTTCTGTTATTTATTTTTGG + Intergenic
1196790395 X:119459226-119459248 ACTTTATTGATAATTATTTCAGG + Intergenic
1197126500 X:122952900-122952922 ACCTCTATTTTCATTATTTGGGG + Intergenic
1198238649 X:134761870-134761892 ACCTCAATGATCATCATTTGAGG + Intronic
1198252363 X:134892141-134892163 ACCTTTATGAGAATATTTTAAGG + Intronic
1198630553 X:138633082-138633104 ACCTAAATGATAAGTATGTGAGG + Intronic
1199242600 X:145565140-145565162 ACATTTAAAATAATTATTTTGGG + Intergenic
1202033292 Y:20602404-20602426 ACCTTTTTGAAAAAAATTTGAGG - Intergenic