ID: 980467379

View in Genome Browser
Species Human (GRCh38)
Location 4:133203401-133203423
Sequence AGGGGCCTTTTCCAAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980467374_980467379 1 Left 980467374 4:133203377-133203399 CCTCAAATAATTATCATAAAGGT 0: 1
1: 0
2: 6
3: 29
4: 375
Right 980467379 4:133203401-133203423 AGGGGCCTTTTCCAAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980467379 Original CRISPR AGGGGCCTTTTCCAAGGAAA TGG Intronic
No off target data available for this crispr