ID: 980470921

View in Genome Browser
Species Human (GRCh38)
Location 4:133250521-133250543
Sequence ACTATATATGGCCTTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980470921_980470923 10 Left 980470921 4:133250521-133250543 CCTGAAGAAAGGCCATATATAGT No data
Right 980470923 4:133250554-133250576 AAAGCAGCATCCCTCGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980470921 Original CRISPR ACTATATATGGCCTTTCTTC AGG (reversed) Intergenic
No off target data available for this crispr