ID: 980470923

View in Genome Browser
Species Human (GRCh38)
Location 4:133250554-133250576
Sequence AAAGCAGCATCCCTCGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980470922_980470923 -2 Left 980470922 4:133250533-133250555 CCATATATAGTTTTTCTGATAAA No data
Right 980470923 4:133250554-133250576 AAAGCAGCATCCCTCGTATCTGG No data
980470921_980470923 10 Left 980470921 4:133250521-133250543 CCTGAAGAAAGGCCATATATAGT No data
Right 980470923 4:133250554-133250576 AAAGCAGCATCCCTCGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980470923 Original CRISPR AAAGCAGCATCCCTCGTATC TGG Intergenic