ID: 980479491

View in Genome Browser
Species Human (GRCh38)
Location 4:133369319-133369341
Sequence TTATATATGCATAAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980479487_980479491 18 Left 980479487 4:133369278-133369300 CCATCCTTGTATTTCTGAAATAC No data
Right 980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG No data
980479488_980479491 14 Left 980479488 4:133369282-133369304 CCTTGTATTTCTGAAATACCTTA No data
Right 980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG No data
980479489_980479491 -4 Left 980479489 4:133369300-133369322 CCTTAATTTTCAGTGTGTTTTAT No data
Right 980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980479491 Original CRISPR TTATATATGCATAAGGAACA AGG Intergenic
No off target data available for this crispr