ID: 980483206

View in Genome Browser
Species Human (GRCh38)
Location 4:133416668-133416690
Sequence ATACCGTGTAACTACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483206_980483209 -2 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483209 4:133416689-133416711 ATGGCAAATCCCAGGAGCAATGG No data
980483206_980483213 28 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483213 4:133416719-133416741 TTGCACTAGAGTATCTGTAGAGG No data
980483206_980483210 3 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483210 4:133416694-133416716 AAATCCCAGGAGCAATGGTGAGG No data
980483206_980483208 -10 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483208 4:133416681-133416703 TACACGGTATGGCAAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483206 Original CRISPR ATACCGTGTAACTACCTGAA TGG (reversed) Intergenic
No off target data available for this crispr