ID: 980483209

View in Genome Browser
Species Human (GRCh38)
Location 4:133416689-133416711
Sequence ATGGCAAATCCCAGGAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483206_980483209 -2 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483209 4:133416689-133416711 ATGGCAAATCCCAGGAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483209 Original CRISPR ATGGCAAATCCCAGGAGCAA TGG Intergenic
No off target data available for this crispr