ID: 980483210

View in Genome Browser
Species Human (GRCh38)
Location 4:133416694-133416716
Sequence AAATCCCAGGAGCAATGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980483206_980483210 3 Left 980483206 4:133416668-133416690 CCATTCAGGTAGTTACACGGTAT No data
Right 980483210 4:133416694-133416716 AAATCCCAGGAGCAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980483210 Original CRISPR AAATCCCAGGAGCAATGGTG AGG Intergenic
No off target data available for this crispr